Description :
From Genome Similarity Track
Location :
Scaffold_3456:535- 1761
Sequence
1226 bases(100 bases per row)
CACGTTGATCCTGAAACGAATCAAAGGCGCGACTACTATGTCAGGCGCTTCCATGAGCTCCGTGCGAGCAAGAAGGCTTCTCGCAAGAGTAAAGTGCCCG
CGTGGCAGGCACTTTGATAAAGTTGAAATGCCTTTGTTTAAACCTTCAACAAAGACCCTGCTGGATACCGTGCTCGGATTATCGCAGCACGTGAACattt
cgagaagttctcNAAGTTCTCGAAGCGCTGCAAGCTAGATCGCTTGCACGGCGAGGCACTTGAGGCGGCGATTCCCTGCGCAATGCCGCCGGAATGCCGT
GTGTGCACTGCCACCCCGGGACAGTGCGCTTGAGTAAGAGTGATCTCAAAGGGTACACGACCGTGCGTGTACCTGACAGTCTTCGTGATCTCCGTGCTAG
TCTGTAAGCACGCGAAACTCCGAACTTTGTTGGCCATTACGACGTTCGTGCAAGCTTTACACCTGCAGTCCATGGTGGGCTTCGTACGCCTTCACCNGAG
CCTGACTCATCTTCGGGTTGGTATGACCAACGATCCGCTCCATAATCCAGCGTGTCGAGCCACGTGGGCCACGCAGTGGCGGTGGGAGAGGTGGGAACAC
GCCCTTCATGTGGTCAACCTTCGGTTGACATGGGTGATTCCCGTCTCCTCGACCGAGTGGCTGCCGTGGAGACGCTTCAGAGCGCTGAGTTCGCCGCTCT
GTAGCAGGAGCTGAGCCTTCAGAAGGCTCAGCTCACGGCGTTACCGCAGACcgcctcgaacttgagcgtcGAGCTTGGTACGAAGCTAGCaaagttgatg
aagcaggtTGCGtcgatcgagaagaaggttgccccttcttcttttgcttcGGCGAGTCACCAACACTAGGtgactcgtgctgcacgtacgACTACAGCCG
CCCGACGTAGAATGTCGGATGGAGGCGCATGCTGGACGGTATGTCCAACATGTAGGCGTTGACGTGCCATTCAAGCACAGTGAACGGACCAATGAACCGC
GGAGCAAGCTTGGTTGCTCCGAAGTCAGAGACTGCATGTTTAGCTAGGTTTTGTGTAGCTAACAGAACCGATGAACCCTTCTTAAATTCATTCGTATTGC
CTCTGCTTACGTTGTctgcgttcagcttctgccgGTCGGAAGAAGCTGCTATTGCATCTTGGACACACCAAATGATGGCTTGTCTACGCTGGACAAAGTC
CATTGCTTCCGAGCTGAATGTCTTGT