Description :
From Genome Similarity Track
Location :
Scaffold_80:53496- 54801
Transcript NameFunction/comments
Hyaar_Emoy2808393hypothetical protein

Sequence
1305 bases(100 bases per row)
TCGGTGGGTTACTCGGCTCCTTTTGCCGCTGCATGGACGGCAAGGAGCGCAAGGATATGCTGGCAGTTGCAACAGCAGCACAAGGAGCAGACGCATCTGC
TCCACAGCGCAAGAAATCGCGCGGCTCTGGATGCGACAAGAGCGAGTTCGTGAGCGTCAAAGCGGGAATGCGGGAATTAAAGAGGCGGCTGGCAGCTGCA
TCAGAAGACGCCGTTGCTTCTGATTCTGATTCTCCTGTTGCCAGTACGACAACAGCAATTAAGGTGTCAAATGCTACACGGGAAGACGTCAAATCGTGTC
GAGTCAAAACGAAGACGACTTCGTTTAAAGCTGCTCGTCCTGTAAAGAAGAGACAAGCGAGCGAAGTGGCAACGAGTGGTGGGGATGAGGATGATGCACG
CTCTGTTGCGTCGAAGAAGACGCTGGCAGAAGTGAAGCGGGAGCTGGAACGCGAGCAGAGAAAGAGAGTGGAATCGCGTATCCAGACGCTGCAGTGGGAG
GCTGAAGCGACGGCTCATGATGTATCTTTGACTTCTCGTGCACCTAATGATGGACCGCGTGGTTGTGTAAAACCAGGAGGAGATAAGCAACTGATTAGTG
GTAATCGAATGGGGGAGCCAGCCGCAACGTCACCGTTAACGATGACAGACGCCAATGAAATGCGCGCAACAAGTACGTGCAAAGCAGGTTCTACTACCCC
TCACATGCCGGTCAAAGCTCTTGCTGGGTCGTCGGTTGAGCCGCCGTGTAAGAACAAGTTTATTACTGGGGATGTGGACGAAGACGTAGTGTATGCACTG
GCGCTTGAAGAGGCGGAACAGAAGCTCGCAACGCCTCAGAAGCCACTACCGTCTTGTAGTGGAGCTGTGAGTGCTACTAACTCAAACTCCGTAGCATCAC
GCAGTCTTCGGGTGCCGAGTGCCTCGCCGATTCTCGCGCAACCGACGTTTCTGAAATCACATGTACATGCGCAGATGCAGCTAAAACAGGATGGAGATAC
TCAGCAGCCGAAACTAACAGATGCCGTGCAGATCGAAGCGAATTCTGAGATTGTGAAAGAGATGGAACGCTTAAGGCACGAGAACGAGATTCTGAGGCGG
TCCAATGAGCTCCTTCGAGCGGCTGCTCTCACGTCGCCATCGATACGAGCAAAGGATCTTGAGAATGGGCAATCTCGCGCTTCACTTGATCATGTGCATG
ATCAGAACGGTGTCTGTTCCACAATGAAGGTTACTCCATCGGGTACCCCGGCTGGTAGTTTCACGACTCGATTCCTTAATTTGGCCAGATGTGATAACGA
ACTGA