Description :
From Genome Similarity Track
Location :
scaffold_13:534835- 536650
Sequence
1815 bases(100 bases per row)
ACATTTTGTGTCAGAAAGGCTAAATACCAGTGGCAAACTGTGCATGCTTATAATGAATGAAATACAGTCACAAattcggcacaaacgccgactCCTGGAG
AAGGATTGTTGCGATACAGCATGGTTGACAGTATTATGTTCTTTGCTTTCGACCCAGTTGATAAATACAATTAAATGCCAAACGCAGATAGCAACCTCCC
TCTTCCTGCTGTGAGTTCTTCGACTTGGATGCTACGGTAGCGGCTGAATAGACTTGGGATCGTCTTACGTGACGATGACGCCAATTTGTCTGGTGGCACA
ACTTGTCAGGTCACGTCATGGCTAAGCACAGACTAGTTCGACATTTTATTCGTTCTTAGTCGCCCAGATCGTGAAAAGTCGGGTTTGAACGACGTGCGAG
CGTACGCGCTCGAGATAGTTTTctccaatgcagacaagagATTTTTTGGGCCGAAAAAATTTCCTTTGAGCTGTCTCATGGAATGGGAGCCCTGCGAGCC
GTTTTCACAGCGGTAAGGGCCAGCACAAATTAATCAGTGCCTTCGTCCCAGATATCTTGCGGAAGTTTTTCGACCTGgacaactacttgcacaagtacag
tgctAACTATGCCGACGTGACACCCGTACTTACCATTTTTCCAGGATTGATAGTAGATCGGGCTGGTCCGCAGCGGACATTGCGACCTTGAAGGCTGTGA
AAAATAGCCGCACGCACGCAGTGGTTAGGGATTTTACACATCCAGATTGGCCGTTAACGTCGTGTGTAACGCTTCAGTCTTCGCAGTAGGCTGCGCTTTG
CTCGAAGCAGATGCCAATAGGTATTTACGTGCGATCACATTTCAGTCTCATCAGCTGCTGAGAGAATAATCACAAGGTGCCGCTTGTCCTTGTCAAGTCA
GGGTGCAAGTGATTGATTCTAAGTTAATACAGATTATGCGCTGTTGCGTTTAGAGCCGTCATTACCACATCTATCACAGATAATGTTAAGATGGTTATCA
TTTTTTGCTATATAGAACGTTGAGGTTAGGTACAGTCCCGGTCAGCTTCATGAGAAGGAAGAGGTGCTCTCTCGTTGCCCAAAATGTGACGTGTTGCATG
gcacgatggtgacgtctcAAGTTTGTACATACGGTGTGCGGATCGGACACAGCATGGAGCTTTTAGTACTAATGATTCTGAGACTTCAACTGGCGCTCAA
TCAAAGCGCATTATTGGAGGTCTGTATTGGTATGGCATATCTCGAAGCACATGATGCCCAGCCTCTAGATGAATCAATGGACTTCAAATACGAAATAGTA
AAAGATGCACAAGATGCTTTTTTGAGCGGCCACCACAGACAAGAAAAAACATACTGCTCAGTTTTTATGGTCCAGCATCTCTAAGCGAGAAACGCAGATG
TGCGCGTGCGAGTACTGTGCCAGCGGATTAATCCTTCGCAGTATGCGGCGACATCTTTTGTCAGTCTGCGGATTCCGGTAGAAATTATCCAGTCGATAAC
TATGGGCTACATGCCAGTCTTGTAATGAACGCATCGGGTAATACCTGAATTGTTGTCCTTGTGGGCGATTCGAGTAAGATAGTCTATCTTGCTATCGTCA
GCGATAATGTTACCGATGAAGATACAACCAGGATGTTCACCTCCAAAGTGGTTCGCCAACATGCTTTGTCGGTATCCATTGTACTAGATTAATGTCCGAC
CTGCACAGCGAGAATTTCGCAAACACAATTTGAGGTGCTCGGCGTCCATTTAGATATGTCAGCCGCTGGAAATCTGCAAACAGATTATCAGACAAACAGC
GTGAATTACGTGGTG