Description :
From Genome Similarity Track
Location :
Scaffold_1144:5346- 6438
Sequence
1092 bases(100 bases per row)
GAAgtcgtcatcttcaacaTGGTAGATGACCGCTCCATACACTGGTAGGTTTTAGATGAACCGACCGTAATAGTTCAGTGCACCCAAGAACGCTTGTATC
TTTTTCGTGGGATTACGAAACGGTAACTCAGCTATCGCGGTCAACTTTTTCGGATTCGCCGAAATCCCACTTGGCGTGACCTCGGGAGCGAGGAAATTGA
CTCGCTGTTGCACGAATATATTCTTGGTGAAGCTAATGTTGATTCTGCACTCGGTGAACCGAGTTAATAGGCAATCCAGTATGGCTAAGCACTCATCGAA
TGTTTTCCCTCCGAATCAAATATCATCCACAAACGATCTGCGTTGAAAGACGGGAGTAAGTTTCGATTCGTCGGATTCACCTCGGCTGAACATGTCACCA
TCAGGTCCGTCAACCAGATCCTGCACTGGGTCAGATTGATCAATTGCTCTATGGTCAGCTTCAAATTTGGTAACTGGACTCAGTGGGGTTGAGCTCAGCT
GAGTCAAATCAATTTATTGTTGATTCCGCTGAGTACCCGTTGGCAACTCAGCTAATCGAACTCGTTCAGCGTGTCCACTCCAACTCCTCGAGGCTGGACG
TAACCCCAGAGAGCGTTATCGTTGATTATCATGGGTGCATTCTTTAGGCCAAACGGCATACGAAGCCACTCGAATGGCCCAAAGCACAGACAAACACTGA
GATCCGTCTCGCCCGCCGAGTCATCATGACTGCCCAAAATTCGTTCACCGCATCCAATGAGCAGAACCACAAGTAGATTTCCAACTCGATGAGTAACTCA
TCAACTAGCGGCATCGCATATTCATGATCGCAGTGAGAGCATTTACCATTTGTAGTCTACGCACAACCGGATATATACCctgttcttcttgagcactATC
ACGATTGGTGAGGCCAAAAGACTGTCAGAGAAGGCGATCGGTCCTGCCTTCATTAACCCTTTCAGCAGTTCATAGGGTTTCGTCAGATGTCGTAGAGGTA
TCCGCCGGGCTCGCTGCTTGATCGGTTGATGTCCTTGTACGTCAATATCACATACCGCACCTTAGGCTGGCGGCGGAAGAGCGTTACCACTA