Description :
From Genome Similarity Track
Location :
contig_29:534552- 536343
Transcript NameFunction/comments
g5840.t1hypothetical protein

Sequence
1791 bases(100 bases per row)
ACTATACCACCTCGAAATGTTTGGTTTTGCTTGCGGAAACTCTATTGCTTGTCGGTAGTGCTCCACATTCAAGTCATAACAATTTGTTTTCGCTACTTCT
TGCTCCGAGGTCATCCCCTCACGTATCGAGTGAACCATAATCAACTTGACTATTGTGCACCGCGGACCCAGTACAACACACTCTCATTGAGTGCGCGTGA
TGTGATAGCGTCGTATATCAGTGTTTTTTGCTAACCAGCGAATTGTGTTCTTCGGTCACTGTCCTCATCGATAAGAAAGTTCAGCGAGAAGTTGAAATCG
AGACGCTTGCCTAGCATGCGTTCGTATAGAAGGCCACGACCATCTTCACTGTTGCGTCCACAGATGGGCTTTTCCAAATGAGGAAACGCGTGCCGCAACA
ACTCTGTTGTCGTCATACTCAGCTTCGCACGGGCAGTCATCACGACAGGGGCCACGGACTCAATCCTTTGGAGCTTCATCTCGGTTCTCGAGTCGAATGC
GGCTTCTCTGCCGTTGATCCACCGACTTCGACGCCAGTTAATGAGAGCAGAGCGTCCCCGGCAGCACTGTAGTGGTCGTGGATCGGCGCGCGAGGAACCT
CGATTTGTATGGATGTGTACGGACTAACTGCCGCCTGAAAAGGCGTAGCGAGACCCGGGCCGTCGTTCTGGTGGCGGCCTGTGGGTGCGCGCGGGTGCAC
AAGACCCACGAGGCTGTCGCTCAGCGGCCTGGGTGCGAGGGGATAGCGGTTCGTGCTGAGTGCGGGGAGTCTTGGTGTGGTTGGCGACTGGTGGGCTGGA
GTTTCTCTTGATGAAGAAGCACGTGCACCCACCACGGTCAAACACGTCACGTTCAACCACATCTTACACATCAACAACGTTCTCGTCCTGCTCTCCCGGG
GGTTCATTTTTATTTCTTCCTCGCCCTCCTCTCCCGAGTGGTGCATCGTTTCGTCTAGGGTTTCCCCAAAGTGGACGGTGATAAATCCACCGGAGAAAAA
AAATAATATGCCGGACATTCCTAACCCTATCGTAAACAGTCATATGTTTATCGATAGCGCTGAAGAACCGTATGAAAGAAAATGACGAGGATAGTGGTAT
TTTTAGTAGTTGATGGGTGACAGAACCGTAGTTTACCATCACGTCTTATCTAAATTCTGAAAAGTCTGTACGGTATGCATACGGTACAAGTGGCAGGATA
TCATACCGGATTCTGAACATGGTGTACCAAAAGTTATTTTTAAGTATCTGATAGGTTCATGAAAATACCCAGAAGCTTAATCGACGATCAGTGCGAGCGC
TATATGCCAAGCAAGAATTGAACTTCCTCGTTGTTTCTGTGTCCTTAACTCTGGTCCCCCTCAGCGTCACACGCACAGTACCGCACGTAACGTAGACGGT
AAAACTGCTCCATGTCGTAGCACGCTTCATCCCACTTGTGGCCACTCAACATCGATTCTAAGAAGAATAGACACCAGTTTCCACACGAGTGACCACCTTT
TTGCTTGCACTCGATCCATCGCTCAAATTGAACGACCTGACACTGGCCACCAAGCTGCCAAATGATTGCATCTCTCACAGCCTTCTCCAAACCTGTGTAA
TGTGGCTCCAACTGCTGCGGGTCAAACAGTGTACACTTGACTGGATTGCTCGTCAAGTCGATGAAAACGCCAGCCAATGGAACCCTTCGGGATTGACAAC
GCCAATTTGACACTCAACCGCTGCATGGAAGGCACCGTTGGAAGCGGCACATTTCCTCTGTCTTGGTAGATCAGTGAATGGATACCAGTCT