Description :
From Genome Similarity Track
Location :
Scaffold_61:53453- 60767
Transcript NameFunction/comments
g13893.t1hypothetical protein
g13894.t1XP_009515921.1 hypothetical protein PHYSODRAFT_552366 [Phytophthora sojae
g13895.t1hypothetical protein
g13896.t1hypothetical protein

Sequence
7314 bases(100 bases per row)
TCTGGTACCATTTTCGTACCTTATCCGGTCACTGCACAATAATGATCCTACCGCGAGCCAAGGGGAAGGACGACAGCGCGGCTGCGGGAGCCTCCGCCGC
CGCCACCATCTGCGAGCTGTGCGACCTGTACACGCACAACGACCTAGACGGCAAGTGGATGGAGCTCGCAGCAGTCTACGACGTACGTTAGCTCGTCGCC
CATCGACCCCACACTGCCAACACCTAACGCTGAGATGTGTCAATTCTTCCCTGCAGCAACGCCATAATGTCGACAACTTCCGGGAGATTCTGGATCTGAG
CAACCCCGACGCACGGATGGGCGACCTCAATGGCTGGCACTTGGAGCGCATGGCCGTGGGGGAGTTTGAGCCGGGGGCAGGCGCCAGCGCCAGCGAATTG
GCGGAGATCAAGCGTGAGAGCCTCCTCATCAAGCAGACGCTGATGAAGGTGATGGCCAATGGCCGCAGCTTCAAGGCCAAGAGAGACGATCTGGAGGCGG
CCATGGCCAAGCAGCGTGAGGAGCTGTCTGCTGAGCTATCTGAAGCCAAGGAGTTTCTTGGCCAGGCACATTTGCTGAACGCCTGTGACTCGGCTGCGAT
CGAGGTTAGTGAGCCAGCGCCTGTGGAGGAGCGACTGCGAGCGACGGTCAAACATCCAGAGCTCTCGCCGACAGTCGATCTCAGCGAAGCACCGTCAATC
TGATGTTGTGAGACGTTAGATGGGGAGGTAAGCGAGTGTGGAATGAAAAACAGGGCGATACACGAGTGCATTCCTCCGGTGCTCTCCCAAATCGGTCACG
CTCTAACTGTAACTTGGTTTGGGGCCACCTGCTCCGTTCTCGCCCTCCTGACTGTCTGTACATGCCGCTGTTTGCTACTGCTCTAGTCGACGTGCAGACG
GTCCTCAAGGTACTTGACGGCGTCCTTCGTGATGATCAGCAGGTCCTTTTGCAGGATCGAGTAGACGTTGATCTTGTTCTGCGGGAGCGTGTCCACGTAC
GGGATGTTGCGCGTCGCCAAGACAAAGCTCGAGTCCACCTCCTCGCCGCCAACGAACAGTGCGTGGTCCCAGCCGCGGCCACCAAGCAGTTTCTTCATCT
CCTTCGTCTTGGTAACCTGTTCGACACATATACACCACGTCAATATCAACTCAATAACCACGACAACAACAGCAGCAACGTACGTCAACGTCAAGCGAGT
CCACGACGGCCAGCTTCCCCTCACGGAGCTTGGTGGACAGCGCCACGCGCAGGCCCATGGCGCGCACCTTCTTGGGCAGGTTGTACGAGAAGTCGCGCAA
CACGGGGCCGTGCACGCGGTAGCCTCCGCGCCACTGCGGCGCGCGGATGTCACCTACGCGGGCGCGGCCCGATCCTTTCTGCTTCCACGGCTTGCGCGTG
GAGCCGCTCACCTCGGAGCGCGTCTTAGTCTTGTTGGTGCCGGCGCGACGGCACGCGAGCTGCCAGCGCACCACGCGCTGCAGGATGTCCACGCGGTCGG
GCGCGCCGAACACCTCGCTGTCCATTGTCACGGAGCCCAGATCCTGCGCGTCCTCGGTCAGCGACAGCAACTGCAGCTCGAGGTCACCCGCGGGCGTCAC
CTTGACGTCCTGCGCGGCCGCGATCACGCGCGGCGGCGGCTGCGGCTTCTCCTCGGCCAGAGCTAGGTTGGCCGGTGCGTGCGTGCTGGCGGCACGCACC
AGACAGGACGTGCGCGGTGCCGATACGGAAAGCGCCGCCACGCCGCGCAGCAGTCGGTTCATTCCCACAGTCGCCATCGGTTCCCCTTTGAGCTGCTCTT
TGCGTGCGGCTCTGGTTGCGAGTGGATGGCGTCCATCTTGAGGTAATGGTACACCATATTGGTGTAAAAATACACACTCTTTGGTGACACAAAAGCGGGG
GTGGAACAGGCACTAAGCAAAAGTCAGACGGCTTTCCCCCGCATCATGGCGTCGCAGAGGAGAGGCTCCGCCCCGCGCGGGGACGGCAGCCTGGCCGCCA
TCTGCACGCTCATCGAGCGCAGTACCCTGGACCGCAAATCCAAGCTCGACAGCACGGGTCGTGTCTGCTACGTACGAGGAGATGAGCCGCCCCTGCGCAC
AAATACTACCGATCTAATGTTTGAATACTATTGTAGGAGCTCAAGAATGACCCGTTGCTGCTGGACAGCTTCCCCATGGACCGGATCATGAAGGCCATGC
GCCGACTGGTGTGTGATTCGGACACGTCCACGCGCGCGGGGGCGCTCCGAGCGCTGCGCTACGCCATCAGCAGTAATGGCAGCATCAAGCACTTTGTGGA
CCTCGTACGGCTGCCTCCTGCTGCTTTAAATATTGCAGAGAAGTTAATAGTTGTGTGTTTCAATTGCAGAATCTGCCGGTGTTTGTGGTGCGGTCGCTGG
AGCGAGAGCAGAAACACTTGGCGGAGAGAGTTCAAGCGCTCAAGGTGGTGCGACGCGTGATGGAGATCGATGCGGCGCAGATGCCGACGGGTCTCGTGGC
GTCGTTGACGGCCGTTGCTGGACACAAGGACGACAATATGCGTCGAGTGTGTCTGGAGACACTGAGAGAGCTGGCGCTGCTGAACGTGGAGGTTGTGGCG
GAGGCGAACGGCACGAAGGTTCTGGTGGATGCGATTCTGGAGCCATCATTCCAGGATCTGGCCGACTCGCTGCTGATGACGCTGCTGCTCATTCTAAACG
AGCCGTCGACGCGCAAGTTTATCGAGCCTTTCGTGGATTCGCATGTACTGTTGGCGCCATTTACAGATACGGATCTGCCAGCAGGTAATGAGCGGCGACA
GCGGTGGATGGCCAGTCGTAACGCCATCGTGACGATGATGCGCTCGTGGGCAGGCATGGTGGTGCTCACGAGTAACCCGCAGGGCTTGCACTCCTTGATT
CAGTTATTGGTGCGACCGGTGGGCGAGGATGTCCAGAAAGCAGTACTGTCAACAATTTGTGAGATCTTTTACAAGAAGACAAGCTTCGACAAGTCCGCGA
CCGATGCAGCAGACACACCGGCACTCCCTATTACTCTGTCGAGCGCAGAGCAACTGCCCCTTGCAGTCAACCACAATTTGCTGGACAACTACACTGTAAT
TATTCTGCTGGCCATGATTCACTGTGGCATCCTGGAGGCTCTGGTGACTCTAGGTGCGGGTCCGTCTCGAGCATTGGCAGAGCCGGCAATTGACCTACTG
GCCGATATTCTGCGTATGGCCTCGCGCCTGTTGCCGGACCAACACTGCGCGTCTTTGCTTGCGCTCCCCCGCCTAGTTTCGGCAACTTCGCTTACAACGA
CCACCACAATGACCCTGGGAGATCACGCTAAAAGTCTTTTGGAGCGTCTTCAGCGTGAAAAGTCAATTCGGGCTAGTGAAATGCTGGGTGAGCTCGCTAA
CGCTGTCGGGGCCAATTCAGGTAGCATTGCTACCCGTGGTGTGTCGCTAGTCTCGTACGGTGGCAGCGGTGTTAATGGTGTTCAGCTAGCGTCCGAACTA
CTTCGCGACACTAACCGACCATCGAACCTTCTCGCTCTCCAGCAGATTGCAGGTGTGGTGCGTCTCCCATCATCTAGCGGCGGAGGTGGCCTTGGAGGAA
CTGGCAGTAATTCTGCCAACTATGCTGTGGCAGCCCCCTCAACACAACGTGGCACTAAGAGCGCGACAGCGCTACTAAAGGACAGCTTGACATCTCGAGA
GCTGATGGTCCTCGAGCTGAAGCAGTCATTGGATGCACAAATGGATGACAGCACATTTAAGGACATGCTGCACAACCGTTCACGGGTGCTGACGGACAAA
AACTACAAGAACTGGAACTGGGATATCATTTCGGAGATGCTTGAAGGCCCACTTACAAACCCGCAGCGACTCTCAGAGGCGATGAAAACCAAGTTCTTTA
AGCGCCTTTCAGGTTTCTTCCGTTGCGACCAAGGCAACAAAGGATACTTTTCGAATCTGTACTGGATCCCAGACCACGTTCCCTACCTGCGCCCAGCGTG
CCAGATGTACACGCTGCTGTTAAACCACCCCGAAGGCTTGCTCTTCCTGAAAACTGATCGTCGTGGTCAATTGCTCACTGAAATTTCGTCTGCACTAGAG
CTGGAGGCACGTCCTGAGGCTGCTATTGTGGAGTCCCATATTGGCGTGCTAAAGGCGCGCATGTTCTCTCCTGATTATGTATCGCGGCGTATGCTACGCG
AGTACTTCACACTTTTGGGACTGATGAGCTCAAGCAAAGAAGGTCTCAAGATGATGGAACAGTCAAACCTGTTCCAGCGGCTCTACGTCATGGGCACCAC
AAAGGGACACGATTTCTTGTGTCGCCTCATTCTTGCCAACCTGGACTACTCTGTTGATGGAAGTTCCCGCAAGTTGCTTCAGTCTTGGATGATGGAAGGT
TCGAAGGCGCTGCGTCTGTATGCAACGTGTTTGCTGCGTGCGTTGCTGCGCTCTGAGGTGGCCGATTTTGATAAGTGGGGCATTGATGCGCTGGTGACTC
AGCTCACACAGGAAGAGGAGGTTGCCAAGGCCGCACTGAGTGTACTTGAAGAGGCCGCTGAGACGCCCGCATGCCTTCTGGCGATGATTCTGAAGCGGCC
TATGAAGCTCATTCAGCTCAAGGATAAACGAGCAGAGTCGCTGCTTTTGAAGTCGCTCTCGCTTCCTGAAGGTCTGAACTTCCTGCGCGACACAGGCGAT
TGGATTCGGCGCACTCTAGCCGCCTGGCGTCGCGAAAAACATATCTCGTACGTCCATGCGGTGGAGCACGCGCTCTTCCGTGGTTTGCACCGCGATGCAG
CGGGGCGTGAGCGTGGTTCGAACAGTGGTTCAATAAATGCACGCCAGACGTGCTCTCCCACTCCTATCCCGGTGAATGTGCCCATGAAGCGAGGTGGCGG
TGTTGGGCTCAAACCGCCTAGTGGTGGAAGCAGCCAGCGATCACTATGGGGACTGGATTGGCTTTACCGTATGCCGTGGAACATGGAGGTGAAGATTGTC
GGGCCTCCAGGAAGCGGGCCTCCCTCGAGCCTCATCTTGGAAACGTATATTGATGGTGCTATGCGCGACGAGGATGAGACGACTGGCATCGATGACGAGC
TTCGCATGAACTCGATTCGTGTCAAGGGTATCGTTGTGGACGCACGCAACATGCCACAACCTGTGGTTGTGAACTCGCAACAAACATTACAAGCTTGTCT
TTTCCTGGGTACGCAACCCGTAGATCGGCGGGGTTTCACAAAGCCTCCCCCGCAAAGTAATGGAGGCTTCGTGTCCACAAGCGGATCAGCCAGTGGTGGA
GGCTCGGGTGCTCTTTCGAGTGATACGCAGCAGAAAATGCTACGAGCGCGGTCAGCGTCAAACTCAGCAGGAGGAAGCATGGATCGCTCCTCGGAGACAA
TGATGTCGTCGCTTGACTTCGCTGACACTGGGTCGTCTTCGTCTGAGGCAGCAAAAGAAGAGAACAAAGATTGGAGCTCGTGCCAACCTGAACAGCGCTC
ACCACAGTACTTGTCGGCACCAGAATGCTCGCTCTGTGCTCCAGGTGAGCGTGCGGTGTGGAACTTCCGTGTGGAAATGGACTCCGCGGCAGGCAGCAAC
ACTTCAAATGGCAGTGTGAAGCGTCTTATGCTCAAGTCTGTCGAGTTCACGTTGCAATTACTTCCTCTTCGTCCACGTACTGTGCCGCTCCCGGTACACT
TGTACGGTGAACTGGCAAAAACCAGCGCTGGCTGCCAGATCCTGCACGCATCTGGGCACCTACCGGAGTTCCTTGCGTGCCTACGCGATGCTGCTAGTGT
CCCGCTTGAGAAGCGTGCTGCATTGTGGGCGCTCGGCCATGTGTCTGCCACACCGCGCGGCTACGATCTTTTAAACCACTACGCACAAGATTTTGTGGAG
ATGATTGTCAAATTGGCTACGGACTCTCCGCTGGTGTCGATTCGTGGTACTTGTTTCTTCGTACTGGGATTACTCGCGCGATCACCCGCAGGACGGCGAC
ACCTTGCACGTTTGGGCTGGGATGCCCCACGGGATGCATCGCGTACATCCATCGCAGTCCCGCAGAACTGCACATCTCTCTTCATGTGGCCGCCGTCTGG
ACCATCGAACCCATGCCCATTGACACAGACACCGCGAGCGTCGCCCCTACAACGATTGCTGGTGCGCAGGCGCGACAAGATACCCAACGATTGGCGTGAA
GTGCTGCGTTTTGTCGCGGACCTGAGTAACCACATCACGCAGAAGGAGGCCCATGCTTCGCTCAACAAACTCCGTTCATCGAAATCCGAGCTGTTTGAAG
AGCCGGTGCTGCTGATGTACGTGCACGCGCTACTGGAGAAGTACAGCTACCGATTGGCTTTACGCCAGTTTGTGCTCAACGCGTTCGACCGAGCAACACT
GACGGATGAGGTGCTTGACACGCTTCGAGTCGAAGACGAAGAGGAGCAGGGGAACCAAACGCGTACTGGCCAGCGTGTACCCTCCGGGCGGGAGCTGCGG
CGGCGTCGCTCGTCGCCGTCGATCCCTTCATTTACGGCTTCGGTCCAGTCGCTCAACTCTGCCATGCAGGCAACGTCTGGTGTGTCGCGCATGTCGTCCA
TGCAGAACGTCCTCAACGGTGGCAATATGGGCGACCACCGTTCCACGATGCGTTTGAACGCGCACAATGACCCCATCGATCGCACTGTGCTGCTCAAACG
TAGCCGCAAGCGCTCTGCCTTCTCGGAGAAGACCATTGTTGTCGGCGCACCTGAAGCTGCTGTGTAGGTTAGGCTAAGATATACCTAGACGATGAGCTTG
GCGTAGCGTTTGCCAGTCGTTATTCTTTGGTGCACTATCTCTATTGGATTTACCTACAAGAACCTCCCAGAGGCCATGTCCATGAGCGAGTCACCCATGT
GGAGAACATCGAGCTTGCACAGCTTCCCGTCCAGAGCAGTGCACATGGTGATGGCACCTCTCAGTGTCTCCAGGCCGCTCCGTTGCACGCGCAGCAACGC
CGTGCTGGGCTCTTTGCTGTTGGCAGCTAATTTATCAAATGATAGGATGTCGAACTCACACGCCGAGGCGCCTACCACGCCGAACGCCGTCTTGAGAGTG
TTGTCCAGGGCGAATTTCAGGCGCTTCACGTCGCCCACAGGCACCGATCCGTCCTCGGAGAAGCTGGGAATAGAGATCAATATAAATTAGGTACTGGTAT
ATATCTAGTGATCTCTAATAATCCGTAATGGGACGTACATGGCGATTTTGAGGTAGCAGTGCTGGCCCTGCAGCGAGAACTTGTGGTGCGGCGCCGACGC
AGGTGCCGCCATTG