Description :
From Genome Similarity Track
Location :
Scaffold_592:5345- 8787
Sequence
3442 bases(100 bases per row)
CGTACATCCACTTCAAATAAACTAGTGTTAGAGTCATTAGATTCAATTCCATTCGACTCGTCATTGCTGTTTGGTTGACCGTGCAAGACAACTTTATCAC
CATCAACGCTATCTGGAAAATTATCCACATCTGCTTTGTCAACATCCACACCTTCTTTTCCGTTTTCACATCCACCATTTACGTCGCCATCATTTCCAAT
ACCGCCAGTTCCATCACTATTGCCACTTCTACTGGCATTATCCTCTCCAAATTCATAGCTCTCACGGGCGTCATTATCGTGATTTCCACCATTATTGCCA
TCTCCATTCCCACCAATATTTTCATCGTCACCGCCAATATTTTCTCCTTCAAAACCAACACAATTGTCTTGATTGGAATTGAGAACACAGCGAGAACCAA
ACTTTTGTAGGGGGTTGCAGGCGCAGTAATCACGCGATTTTCTTCATTTGAATAATGCCTGATCAACTCGCTAACCCAACTTTGCTGACTGTTGGGCTTC
GGTGTGTCCTGAATAAACTTCTTTAAATCACGACAGAGCCCAACCAGATCTTTATAGCTGCATTCGCCCTTCTCACATAAATAACTGCCATAATACTGAA
TTACTGTGTCTTCGTAAGGTTTCATTCTGCGCGgacgcccccccccccccccccccacgtATACGGTCAGAGACAACAACGTTGTCCAGATTTTCCCAGT
AGCGTTTCCGCCAGTCTTTCAGTGTTGAGTGCTTTACGCCCAACTCCcgcgcagcatcttcaatACTCCATTCCAGGTTGGCCTTCCACCAGTTCAGAAG
AGCTATTTGCTCTTTCTCGGTTCTTTGTACGCAAACGCGCCTGAACATCCGAGTTCGAAACCCTCCAAATCTAAAGTAGAGCTGATAGGGGCCACTCAAA
TCAAGTATCAGCAAAAGAATCAGATTCCAGCGAGTTATTCTTGAACTAGCGAGTTATTCTTGATCTATCGATTTGGTTTTGGCCCAAGGCGTTGTTCTTA
ACCCAGCCATCTGTTCTTGACCCAGTCAGTTATGCTTCAGCCAGCGTGTTGCAGTATGGCAAAGTAATGCTTGTACAGCTTTAATCAAGCGGAATAAAGC
TAAACAGAAAGCAGAAAAACGAAGTGTGGTATGAGCATAGTTACATCGATCCACCTATATGCGACGCGTTTATTAGTAAATTTGTATACATTCAAATGTT
GCATTACTGTGCAGATAACGGTACTACTAACACAATCACTGTACTAAAAGGACAGTACCGTAACAGTGCATTGAGTACAGGGACGGACCGAATAGTACTG
TAAGTAGTCTCAACACTACTCAAAAGTTATTGAAGGAACCATTGTATCACTCACCGCTTTGCTTTCACCATGGAATGCGAGTTCTGGGTCTACTGCTGGA
AACGCGGAACACCTAAAACAAAAGCCTACGTGTGGTCGTGCAAGGATGTTAAAAAATAAGCTCGACAGCTCAAGGATGAAGTTTTTCTACGCAGTCGGCT
TGGCAAAGCAATGCGTGCAAAGTAGACGTttcagcgacagcgaggaggatGAAGGTCCACATAACGAGGTAGAAGTCCTCCAACGATGTGTTCGTGATAC
AAAAGTAGACATTGTGCTGCACCGGACTCTATGTTGCTGAAACGGGCGCTGGCTTCCTATAACGCGCGGTGCGAGATTGCTCGTGAGCAACGCCGCAACC
AACGCCGACAAGTCCATCTACAACATGGCATTGACAATACCATCAAGTTGGCACATCAACGCTATGACGTTGACTCGACAATTGCTTCAGCACCATCGCC
ACCACAGTTACCAGATATCGCATCAGCTTTATCATTTCAAGATTCAGTGCAGCCGGGAAGACATCGGTGGCGTAGTCCATCGCCTGATATGTAGGTTGTT
GACGCTCGCAAGGAAGAATGCGTAAATGAAGAACTTTTGTTCCGTTACGTACTTGCATATGCCTACGCTCGAGGGGTCTACTTTTCCTTTTGCTTGCTTC
ACCTACAACTTaaacgcccccccccctcctgCTTATAAACACAACACTATAATTGCAGTATAAAATCCCACACACTAAACACATGTATTATTGTACTCTG
CATCAGTCGTGATACCAAGCTTTAGCTCCTCATAGAAGCGCCTTAGACTGGGAAAACTTATATCGATAGTTAGATATCAAGACCGCTGGGTCCAAACATG
AGGTCGGTTTTAGCTAATTCGCAGTCATTTTGACGCTACAGGCCTTCCAAAAACGTCATTTCAGATCTGAAAAAGTTGGTGAAAAGGGTTGGCCTCGTTT
TGCAGAATTCAAGGCTCCTTATTGGTCAATGAAGACCTTCATGTGGTTTACAGGAGAAAGGCGAACTGCTACAGGCCTTCGTCATCTCGTACCACAGTTT
GACATACCAACAGCGAGCTGACATCTCACAAGAAAAATATTCATTTATAAAGGCGTAGGTTGAAGATGTTTAACGGCTTTGATTTTGTCATCCTCCTTTT
CCTGTACACCATATGCATGTTTAGAGGTCATTGATAAATTACAGTTAAATAACTGGTGCAGCAAATTCTACCTCAAAGTTGGTCACCTGGAGCGCGTTGT
AGAGCAAAATAGCGTGTGCAACCAACTCAAGAGGATAGCCAAGACACTCAGCAACCAACTTCCTCGTGCGCTTTTCGTCGAAAGGCCTAGTTATTTCTGT
AGGGCGAAAATCCTGTAGTTTCTCACCatcattttcttcttcctgctaCTGTACTCGTGTTGATCAACTTTCATTTTTGCTAAATAGATTAGGTATAGCG
AAGGAAGGAGTGTAGTACTGTGCTATGGAAACTATTAGCTATCCGTTACGGGTCTGTATGTATATATACGTACTTTATTCGCGCCACTACAACGTTAAAC
GTGACCGGTTAAAATTACTGATATCAGGGCTTATGCAGAGTACAATAGTTGCGGAGATACTGAATCACCAATGCACCTCTAGCTAACGGAGGACGCCCTG
ACCTCCAGGCTTCCAAAACCGATCTTGAGCGTCTATTCTTGTAGAGGTCTGATCGCTTCTACTCTGTGTGTGGCTTGAGCCCATGTGAGGTTGGACTTGC
TCTGAAACGTTGGTTCCAGTCCAAATTGGGGTTCGTGCAGGTGAGTTAAATGGCTGCAACAGTAGTGAAATCGGCTGTAATTATTGGTCAAATTGTTGCA
GTTGCCGAGTGTGGAGATGCATTGCTTCTGGTAACTCTACGCCTGGGAGAAACCTTTTTGAAACCTTCAATCAGCAAGCGCCCTCTGCGTGAAGGTTCCC
TCTTGAACAACAAAGGCTTCGACATGCTGCTCACCTGTTAAGTTGGTGCAATATCCAAAAAGGGGTGGAGATACAACGTCACTGTCATACTGTATAGTAA
CACAAGTTGTACTATCCGAAATGGTATCACTCCATCGCCAAC