Description :
From Genome Similarity Track
Location :
scaffold_179:5345- 6583
Transcript NameFunction/comments
g5186.t1 actin-like protein

Sequence
1238 bases(100 bases per row)
CATCAGTTTGCACGAACCATCAGAGTAAGTTGATTGTATCTTGCTGCTATTGATTCGCTGTATGTTGACATTTATGCTTTTTTTATTGGTTTTTTTTTTC
AGCCCAATCCTCGCTGCCTGGCAAGGATGCTGCGCTTTAGCAGAATCGAACGAGTTTTCTCAACGTCTTGTAACCAAGAAAGAGTACGAAGAGCACGGTA
GCAACATCTGCTTGAAGCGCTTCTAACAGGTAAATATAAACTGACGGGTACCAGGAATGTATTTTTTCACTCGACAGAATGATGGTAAAATCACCAACGT
GGGCTTGAAGTCGATCCTCTCACTTCCCAATCGACCACTTCGAGTTCACTGTTCACCATGAACTCCCAACTACGTCGCTGTATCGGCAAGAGCGTCATCC
AGACGCAACAGCGCTCGATGAGTTTTAAAGTGCGTGTTGGAGGCTTCGAGGCCCCAAAAGCCCCAATCTCCGAACGTCAACGTGTACAGCATACGTGGTG
TTTATCTGGAGATAAAACACTGGAGAAACTACGCGTAGCCACCCCTGGTCTCACTTATATCTCGGTGGCTCCTCCGTCGTTCTTCGACGAGATGGCTCAA
GCTCAAGGTACCAGCAGTAACCAGCTTTCAGTGGTGGCTCGAGTCTCCAGCGACGCCCAGAGTCTACTCGAACGTGTCGATGTTCTAACTCGAGGATCCA
ACCGCCTTCTAATTGGATTCGACCCTCGTCCACCTCGTGGGTGGCCTGTTGAAGACGCCGGAGAGCCTGGAAAACATCTACTGACTGAAATCTTCGTACG
TGAAGCATCCGAGCTCCGTAACGTTGGTGCTTTTGGTGGTGGGTCTCTGGTAGTGACTGACAGTGAACAAGGAAGTGTTCTCGTGAACGATCGACCGTAT
GGGAAGCTCAAGCTGGCGGCTTTCGGTAGTCGAGTGTTTGTGAACCAGGAACATAAATTTCGTCTTGGTAGAGTCTCCTTATTCGCTGGTAGAGGCGGTC
AGATCTACCTGTCAGCTCCGGAAATCTTTGCTAAGGATCGTATTCGTGCGGCGGCAGGACGTTGGGGAGAATCAAAGATTCTCATTCAAACGCCAACGCT
CTCCACTCCAAGTCTCGGAGCAGCAGCGACTGGATCTGGTAGAATCCGCTTCACTTCTACCACGGATGAAATCGACTGTCGATGTGAGAAACAGACGCTG
GTCATTGCAGGCAATGGGAGCATTGACACTGGGGATAT