Description :
From Genome Similarity Track
Location :
contig_29:534495- 536343
Transcript NameFunction/comments
g5840.t1hypothetical protein

Sequence
1848 bases(100 bases per row)
TTGTCCAGGAGCAGAGTCGCATGTGGAAGGCGAACGTGTGGGATGCAATTATGAGGCACTATACCACCTCGAAATGTTTGGTTTTGCTTGCGGAAACTCT
ATTGCTTGTCGGTAGTGCTCCACATTCAAGTCATAACAATTTGTTTTCGCTACTTCTTGCTCCGAGGTCATCCCCTCACGTATCGAGTGAACCATAATCA
ACTTGACTATTGTGCACCGCGGACCCAGTACAACACACTCTCATTGAGTGCGCGTGATGTGATAGCGTCGTATATCAGTGTTTTTTGCTAACCAGCGAAT
TGTGTTCTTCGGTCACTGTCCTCATCGATAAGAAAGTTCAGCGAGAAGTTGAAATCGAGACGCTTGCCTAGCATGCGTTCGTATAGAAGGCCACGACCAT
CTTCACTGTTGCGTCCACAGATGGGCTTTTCCAAATGAGGAAACGCGTGCCGCAACAACTCTGTTGTCGTCATACTCAGCTTCGCACGGGCAGTCATCAC
GACAGGGGCCACGGACTCAATCCTTTGGAGCTTCATCTCGGTTCTCGAGTCGAATGCGGCTTCTCTGCCGTTGATCCACCGACTTCGACGCCAGTTAATG
AGAGCAGAGCGTCCCCGGCAGCACTGTAGTGGTCGTGGATCGGCGCGCGAGGAACCTCGATTTGTATGGATGTGTACGGACTAACTGCCGCCTGAAAAGG
CGTAGCGAGACCCGGGCCGTCGTTCTGGTGGCGGCCTGTGGGTGCGCGCGGGTGCACAAGACCCACGAGGCTGTCGCTCAGCGGCCTGGGTGCGAGGGGA
TAGCGGTTCGTGCTGAGTGCGGGGAGTCTTGGTGTGGTTGGCGACTGGTGGGCTGGAGTTTCTCTTGATGAAGAAGCACGTGCACCCACCACGGTCAAAC
ACGTCACGTTCAACCACATCTTACACATCAACAACGTTCTCGTCCTGCTCTCCCGGGGGTTCATTTTTATTTCTTCCTCGCCCTCCTCTCCCGAGTGGTG
CATCGTTTCGTCTAGGGTTTCCCCAAAGTGGACGGTGATAAATCCACCGGAGAAAAAAAATAATATGCCGGACATTCCTAACCCTATCGTAAACAGTCAT
ATGTTTATCGATAGCGCTGAAGAACCGTATGAAAGAAAATGACGAGGATAGTGGTATTTTTAGTAGTTGATGGGTGACAGAACCGTAGTTTACCATCACG
TCTTATCTAAATTCTGAAAAGTCTGTACGGTATGCATACGGTACAAGTGGCAGGATATCATACCGGATTCTGAACATGGTGTACCAAAAGTTATTTTTAA
GTATCTGATAGGTTCATGAAAATACCCAGAAGCTTAATCGACGATCAGTGCGAGCGCTATATGCCAAGCAAGAATTGAACTTCCTCGTTGTTTCTGTGTC
CTTAACTCTGGTCCCCCTCAGCGTCACACGCACAGTACCGCACGTAACGTAGACGGTAAAACTGCTCCATGTCGTAGCACGCTTCATCCCACTTGTGGCC
ACTCAACATCGATTCTAAGAAGAATAGACACCAGTTTCCACACGAGTGACCACCTTTTTGCTTGCACTCGATCCATCGCTCAAATTGAACGACCTGACAC
TGGCCACCAAGCTGCCAAATGATTGCATCTCTCACAGCCTTCTCCAAACCTGTGTAATGTGGCTCCAACTGCTGCGGGTCAAACAGTGTACACTTGACTG
GATTGCTCGTCAAGTCGATGAAAACGCCAGCCAATGGAACCCTTCGGGATTGACAACGCCAATTTGACACTCAACCGCTGCATGGAAGGCACCGTTGGAA
GCGGCACATTTCCTCTGTCTTGGTAGATCAGTGAATGGATACCAGTCT