Description :
From Genome Similarity Track
Location :
contig_42:534481- 543388
Transcript NameFunction/comments
g9136.t1XP_009514041.1 hypothetical protein PHYSODRAFT_466574 [Phytophthora sojae
g9137.t1ETP31759.1 hypothetical protein F442_19401 [Phytophthora parasitica P10297

Sequence
8907 bases(100 bases per row)
CTCCGGTTGCCACGACTGAGACCCCTGCTGCTATGACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGATGC
CGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCACC
ACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACTATCAGCTCTAGTTTCGAGTATAGCGGCACCA
ACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGAGATGTCCTCCTGCACCACTGAAGACGTGTCTCTGACTGACCCTTGGCCCCATGAGCGAGG
AGGTGACGATGGTCTTCCGTGGCCCCATGAACATCTACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACGACGC
CGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGACGGT
ACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGTTGTG
AAGTTAACATCATGACTGAGACCAACTGCGCGGACGAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGAT
GTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTGCCAACCTGCCCGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGGCTGC
AACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCACTACT
ACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCGGCGA
GGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCTCCGTG
GAGAACCTGCTGAGTTAAGTGGCTTGCCGACAAGTCTCGACTTTGCATTGGATGTTGGAATGAATGGGTATTGCATCAGACCAGATAGTATCGCTCTCTG
CGCGCGCTGGAGATAATACGATAGCAGTGTTATTCTAGAAAAGTGCTGGCCCGATAATAATGTATCATTCGCTGTGTAGTGCCCGAAATAATGCGATGCT
TTCATCGGTCATCATGAACTGGGAACCGTACAAGCAATACAGCTGTGTTGTCTAATGCATTTGCAGCGAGCGAGCGCTGCCATTGTGCAGTGTGAAGCTG
GTGGCACTGTATCTATCGGTGAGGAAGCTGCTTCAACTATCAGTACATCAGTTGTTGCATGCCTGTAAAGCTGCTTTTAGTCACCGCCGTCAACGCGCGG
TGATACCAGTGCAGCACTCGCGCGTCGCTGAAGTCTATCCGCGGCAGGAGGAGGAGGAAGGGCAAGGCGAGAGCAAAGCCGCGTTGAAGCCGACGGCAAC
GCTACGAAGCGGTGGACACAATGAGGGTCCTTCAGTCCGCCCCGTGCTCCATGGCGCGCGAAAGATTGGATCGGCTAGACGATGGTGAAACGAATCTGTC
GTGGTCGTCGCTGTCGGCCAGCAGTTTGCAGCAGCGGTTTGCAGCTCCCTGCAAGGGATTGAACTCTACTGGACACCAATTCCTGCAGCTCTCGGTTCGC
AGTCATCAATGCACCCAGAAGACGTTGGGCTGTCGCCACTGGGGTACGGGCGCACGAACAACAGCCTACTGGCTGAAGCATGGTGCGCTCGCAACGCTGG
CAAATCAGTCCCGCATGACATGAGACTCCTGACTCTCGTGGGATCTCTTTCGTACAGCGAGGTAGCCACACAATGTCGGCGCACCACTCCAAACGGATTC
ATGCTGATCAAGCAGAGCGCGACGCCAATTAAAGCGCGCGAGAGACTTGCAGGCGCCACAGCGTTAGCCCCATTAGCATATAATACTTACAGCAGACACA
CACGCTGGCCGAATATCCGCAGGCGAATCAAGTCAAGTTCGGCATGGCGTTTTGGTGTTGCGGCGCCTACGTGTGACTCTGGCGTAAAGTATGTGGATCG
GCTGGGCACCGATTCAGCGTGGGCATACAAAAAACAAGATGTCGAAGGCAAGTCACGAGAGTGGCACCTGAACACGAATACCACAGCGACAGGACGACCA
CCCACCCCGTCTAATTTTGTCCCTTTTAATTCAATATTACAGGTAAGTGACCTCCACATTATGCAAATAGTTACTACGTCTGTTGAAGCCGTCATTTCTG
ATGTCTTCAGAATCCCTTGCCATCATGAAAAATGCTAATTCGCAGGTCAACCGCGGGCAGTCATTTCGAGACAACTAGTTGCACTGACGTTGCAGGGCCC
GCCAGCTGGCGATGGCGTCTATGGCCCAGGGGCGACTATTGCCTGAGATAAGCGCCCGTCGTCATGAAGCTGGCCACCTCGGCCCACGCCACGATGTGTA
TGGCATCCGTCTGTCTCCATTGCTGATCGAACCGATGCGGACTTATCCAGGCACACGAGTCTGCAACGCAACACGATCCCATTCTGCAATTTGCCGACTT
GGCCTCACATCCTCCGTCCCACAATGGTTAAGGTCTTCCTCGCCCTGAGCGCCGCGCTGGTGATGGCCGCCCCCGTGGCCGCGTCCGTGTCCGTGAGCTT
CGTGAACTCGTGCTCATACGCCATCAGTCTCTACGACAACAGCAAGACCGAGAGCATCGCGGCCGGCAGTTCCATGAGCCGCGACTTGGCCAGCGGCTAC
AACGGCATGTTCCGCGACGGCACCAGCGACGAGGCCACGCTGGCCGAGTTCTCCGTCACGGGCGGCTACACGTGGTACGACATCAGCGTCATCCCGCCCG
GAAGCGGCAGCTGCTCGTCCTACGACGCGTGCAAGGAGCTCACGGGCAAGTCCGGCTACAACGTGGCCCTGAGCATCGCGCCCGACACGAGCTCGACCAA
GTCCGTCTCGAGCTCCTGCGCCACGCTCACGTGTGAGAGCGAGGAGTGCTCCGACGCCTACCTGTACCCATCGGACGACAGCAAGACCCACAGCTGCCCG
GACACGCTGCCCTTCACGGTGACCTTCTGCCCTGGCGGCTCAAGCTCCAGCACAACCACAACCACGACCACGTCGTCGTCTGCGGCGCAACAGTCGAGTC
AGTCGACCACCACGTCGGCCCCTACCGCCACGACCGCCACCCCGGAGGTGCAGAGCGACTACAAGTCGGGCACCGTCATCACGTCGTCGGGTAGCACCAC
GACGGCTCCGACCAGCACCACGGCAGCTCCGACCACGGCTCCGTCGACCAGTCAGACCCAAACGCAGACGTCGACTTCGACCACTTCCACGTCGACGACC
ACGACGTCGACCGGCACCGCCGCGTCGTTCTCGAGCGCGACCATCAGCTCCAGCTTCGCGTACACCGGCACTGATGCCGGTTCGGCTGCTGGCACGTACG
GCAAGGTGACGGAGATGTCCTCCTGCACTACGGAGGACGTGTCTCTGACCGACCCCGTCGGCCCAATGAGCGAGGAGGTGAGTTTGGTCTTCCGTGGGCC
CATGAGCATCTACAACATCGCCGTGTTCAACGCCAGCTCTGGCAGCGACTGGAGCAAGGTGTCGGCCTACAGCCAGAACGGCACGCAGGACAACATGGTG
TTCATGAACAACCTCAACATCGATTACACTGGTGCCGACTCGAGTCCTCAGGGCTACGCGACGGACGACGGCTCTGGGACTGCCACGAGCTCCACGGCGT
TCGGCGGTTCCCTCGCCGACGCGTCGGACTCGTCGGTGACTGGTGGCGGTCCGTGCGTGTCCACGGGTTGTGAAGTCAACATCATGACTGAGACCAACTG
CGCCGATGAAGATGGCTGCATTGGTTACTACGACGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGATGTTCGTGACCAAGGTGCAGATGCCCACG
GGCGATTCCGTGAACCGCCCGGCCATTTGGATGCTGAACGCGCAGGTTGTGCGTGCGAACCAGTACGGCTGCAACTGCCGTGGCGAGGGCGCGGAGGGCG
GCTGCGGTGAGCTTGACATCGCCGAGGTCATTGAGACCAACACGGACAAGGACAAGGTCTCGACCCACTACTACTTCTACGACGGCAGCGTGTCTGCGGG
CGGTGACAACTACGCCTCGCGCCCCACCGACTCGGCTGTGACGTACGTGACCATCATCGACAACTCCAGCGATGGTTCCATCAAGATCATCGAGCTGGGC
GGCGACGACTTTGACTTTGACGTGGACGCCGTGACGGCCGACCAGGTGACGTCGTGGTTGTCCGCTTCCGTCGAGAACCTGCTGAGCTAAGCAGCTCCGA
AGTGTCTGGCATCTGTAGCCGCGTAAGCTGAGCTCTGTGGTGTGTTTGCAGTGCCGTGGCATGGCCCCTCGCTGGTTGCGACTAATAGATGAGGCGGTCA
TTGCTGTCTCTCTTTCGCTAGAAGCTCGCACGTAACTTGATATCTATACAACGAGATTTTGACTACTCTCTTCGAATCACATCAACCGCACAATGATTGA
GCCCCTTTGCTGCGGTAGTCGTAGTTTCTAGTACCGTTTGCGTTGTCTTGCACTCTGTGGTCGGTGCTTCGCTATCGGATACCGGTGTAGCAAAAGGGAT
GGTACTTCTAAGCGTCCGCCGCACCTGGTATCGTCCCCACACCAAAGTTATTTGATGATAGTGCTGATTGAGCAGCCTTGCCAGGCGTGTAACCCGTTAT
CTCCTTGTACTGCTTCACCGTCGCCAATGCGCGATCGCCGTTCACCGAATCGAACAGACCACTCGTATCCACGACGTTGGCCGAACAAGCTCGGCCCAGC
GACGCACTACAGTCGTCCGCCGTCGAAATACTCGCCTTGGCTGGTTCGGCCAGCATGGGTTCCGCCGTGTCTTCGAAGAAGTTACGCACAACCATGCAAA
GATTATTTCCCCGAAGGGCGTCCTATAGGTATTTAGCTTACAGAGTCTGAAAGGGTTCATGCCTGAGCCGGCTACCACCATGCAACCTTCCCCACCTCCA
GATAGGCACACGGCGACACAAGGAAACTTTTCTGCTTACGTCTTGTCTTGAAGAAAACTTGGACGGTGCGCAGTTTCGTCATGCAGGTCGCGTGACGTGA
CATCCGTTGAGCAGCTCTCGAGTCGACGCAGCATTCTCCTCCAGCCTTACGTCCGCGCTGGGAGGTCCACCAAGAATTATTTTTAATGTGGCGGGTAGCT
CCTCAGCAGCGAACAGCGGGCTGTCGGGACTCCTTTAGCAATCTTCTTCCTCCTCCGCATCCTCGCCTCCGCGGAGGCCGGCGCTTGTGCGGACGAGTGC
GCTTGACGGAGCGAAATGAAAAGTGAGAGCTTGCTGCAGCAGTGAAGTACCCAACAACACCGTCGAGAACACCGTCGAATTGGATGCAGGCGCTGGATCA
TGACAACAATGTTGGAGTGCGTACATGCAGCAGGACAATGCGTGCGGCCAGCAATGGTTAGACTTGACAGAACTGCCACCATGTCTGGACTGGGCAGCAG
CTCTCACTTTTGATTTTGATCATACATTTCGGCAAGAAACCCGGGAGCAGGCCAGCTCCCCTCGCTAGTGTTTTACACTTGCCTACACTGTGAAATATAC
GAGAGTTCATCAAACAATAGCCGACATTCACGTCAGACTTGTCGTACCCTCCGAACATCGGTGAATGAGTCTATTTGAAATTCCTGGTAGACTCTGAAGT
AATTTCAGAAACATTATAATATTTTAAAAAACAGCAGTTTCGCTCCATCCTAAAGTTACTTTACTAAAATGTAATATCAGTACTATCTCATTTGTTTTTG
ACTCGAATGAGAGGCTACGAGCGCGAGCGTAGTTGCTAATGACCATAGTGGAGGTCACCCCACGAGTGAATGGTACATTACATAGGACCACTTGAGCAAT
TTTCCGTACCTTGCGCTCAGTTAGTAGCACAAGGCCACCAACAGACTTGTCCACCTTAAACCACGGTAAGTTTGCTCATTCTCCACGCCCTTCATTAAGT
GCAATAGCCTCTGTTGTTCGGCGTATGAAGTGAGCCAACCCACCTGCTCGTACGCCAAGCTGACTGTGACGACCCGTGTGTGGCCTGTGGCCGTGACGTC
CTTCACTTTTGCAGTAATGAGCTGGATGACTTCAGTTGTTCGTGTCTGTATTGCCCGTGGTGGCGATATGTTCTGCTAGTGGCACCCGTACTTTCGGCTT
ATCTTGATCAAAGAGTCTTGTGGAGGAGGCGCGCTAGAAGAGAGGTGTCGCCCCCCCGCGGTTCGGGCAGGCGGAAGCTTCTAGAAGCTTCCACAGCTGC
CGTACGTCTGCCTACTTGTATTCACGTAAGTTTACTATATCATATACTAAACTTTAATGTCTGCACTACTGTTTCAAATCGGCTAGCACCCACCCTTCTA
TCTGGCCGCGCGCCCCTCTGGCTTCAGCATTTCCCCACTGAGATCGCTTCGCGTCGTCGCTGCTACTGAGGATTCGTCTGACCCTCCTGCCCCATGCTGC
TTACCGGGCGGCCGATTCTTGAGGGCTTGAATAGGTCTCTCGGTTGACGTTGCCTTCTCCCTGCGATGCTTCGTGCTGGAATGGCGTCGCCTCCTCGAGA
CGATGTGGAGCCTGCTGTGCCTGCCTCACCACCTGATACGTTTCCTGCTCAGCTGGCACTTCCCCACGCACCTGTAAAATTCACCTGTGGTTGTTCTTGA
TGAAGATGGCGACCCGGACTCAGATATCGACGCCGATGACGCTGTGCTTTGGATTGCCATGCTTCGCAGGATTGTGATGAAGCAAATTCTCGAGCAGCTC
AAGGCTGAGAGACCAAATGAGGACCATGGTAGCGAGAGGGACGGCGCTTACACCACCCACGCTATGCACCAAGCTTTGCAGAAGCACTGAAAACAGCTTG
TGTTCATGAACAAGATATTCAAGTGCAAGAGCGACAAGCTTGTCAAGAATGCCATCAGGTGCAAGAAGCATGCTCTCTTCATTATTGGACGGCACCCTGG
ACAGCAGGAGGGTTCTTGGCATTGTATTGCCAGAGCCACTGTCGGTAAGAAAAACCTCTTCATTGAGTCCGACAGCTACATGTATTTTCCTAATACTGTA
GAGAAGCTTAGCTCATACTTTGAGCACGTTGACGGCGTGTACGTTATCGAGGATATTGTGCAGTACGGAGTACCCAATAACTGGTACAATATATTTCCTT
TCACTTGATTGCTTGTTTAAATACTCTTGATTATTGCAATTAATGTAGTGTGGTTAACATGAAACGATGAGTGATTGCACATAATTATTACGCTAATTTT
TGTAGAAGGGTTAATACCTTTTTAGAAAGGCCATTACGCAGGCGTAGAAAAGTCGGCTTTGCAGGTGACTTGGCGAATATATCTTCCACCATTTCCTTAG
TGCTACAATATTTCATCTTCGCTCTACATTTTCTTGTACGAAGCAGTAGCGAATAAGGATATGATTGCTTCTATCATGAAGTTCTGGATTATATGAGAGT
TTAATACAGCTCTGGTTGTCGTCGTAGAGAGTGATGACATGTGGGCTACTGTGGTCTAGCACTATCAGTAGGAGTTTTGAGAAGATGACTTCCTGCATGC
AGTGGCATAGTGCGACGTATTCTGCTTCAGTTGTGGATAGCACGACTGTGTGGTGTTTCCTAGACTGCCATGAGATTGGATTGCCACTTATGTAGGTAAT
ATGTCCTCCTACATATCGACATTTTTCGGCGCAGTTATCATAGTCTGCATCAGAAAAAGCTGTGAAGTAGCGCTTTGTGTTATATTGCTCCAGGTTTTCC
TTTCCTCCAAGGATAATGCCGAGGTTGCGTGTACTATTTAGGTATCCACGGCTTCTCTAAACCGCATTTCAGTGTTGTTTTCCTGGATTAGCCAGAAATT
GATTAGCTTCACGTAGAAAATAGGCTAGGTCTGCCCATCACCAGGTACATGAAGCTACCAACCGCCTTTCTGTACGGAATCGCCTTCATCTCATCGTGTT
CCAAAGGAGTTTGTGGGCACATATCTAGAGAGAGTTTGATAGTCAGATCAGTGGGTGTTTCCACTGGATATGAGTTTAGATGGGAGAAGCGGTCCAGGAC
TTTGGTAGCGTATTTCTCTAGGTAGATGGAGCGATTTTTTACGATCGCGTACAATGGACCACCCTAAGAGGTAATGGGCTTCACCCAGGTTGGACATTTT
GAAGCGCTGTTTGAGTGCGTCCTTGATATAAGTGACAATGTCAACTGTGGGTGCAATGATGAGAAGGTCGTCGACGTAGACAGGAATGTAACATGTCTAT
CCGTCATTTTCCCCTACAAAGATGCTACTTCATCGTAGCTAAGTTGTCAAGTGCCAGATTCGAGGGGCTTGTTTAAGGCCGTATAGACTCTTCACCAGAT
CGCATACGAAGTGTTCTTCACATCGGCGAAAGAACCATTCAGGTTGTTCCAGGCATATTTCCTCATCTAATGGAGCAGCGATGGTAAGAAGCAGTCGTAG
GACTTCCATGCGGATGACAGGGGAGGAAATCTCGTCGTAGTCAATCCCTATCTTAGAAGGACACCCTTAATAACTAGGCGAGCTTTGTAGTGATCTATTG
TGCCGTC