Description :
From Genome Similarity Track
Location :
contig_42:534479- 535676
Transcript NameFunction/comments
g9136.t1XP_009514041.1 hypothetical protein PHYSODRAFT_466574 [Phytophthora sojae

Sequence
1197 bases(100 bases per row)
AGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTATGACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGAT
GCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCA
CCACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACTATCAGCTCTAGTTTCGAGTATAGCGGCAC
CAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGAGATGTCCTCCTGCACCACTGAAGACGTGTCTCTGACTGACCCTTGGCCCCATGAGCGA
GGAGGTGACGATGGTCTTCCGTGGCCCCATGAACATCTACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACGAC
GCCGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGACG
GTACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGTTG
TGAAGTTAACATCATGACTGAGACCAACTGCGCGGACGAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAG
ATGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTGCCAACCTGCCCGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGGCT
GCAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCACTA
CTACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCGGC
GAGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCT