Description :
From Genome Similarity Track
Location :
contig_42:534470- 543377
Transcript NameFunction/comments
g9579.t1XP_009514041.1 hypothetical protein PHYSODRAFT_466574 [Phytophthora sojae
g9580.t1ETP31759.1 hypothetical protein F442_19401 [Phytophthora parasitica P10297
g9581.t1hypothetical protein

Sequence
8907 bases(100 bases per row)
CGGTTGCCACGACTGAAGCTCCTATTGCCACGACTGAAGCTCCTATTGCCACGACCGAAGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTATGACCGA
AGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGATGCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCC
TCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCACCACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCG
GCTCCACGGGAGACTTTTCGAGTGCCACCATCAGCTCTAGTTTCGAGTATAGCGGCACCAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGA
GATGTCCTTCTGCACCACTGAAGACGTGTCTCTGACTGACCCTGTTGGCCCCATGAGCGAGGAGGTGACGATGGTCTTCCGTGGCCCCATGAACATCTAC
AACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACGACGCCGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACA
ACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGACGGTACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTC
CCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGTTGTGAAGTCAACATCATGACTGAGACCAACTGCGCGGACGAG
GACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGATGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTG
CCAACCTGCCCGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGGCTGCAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGA
GCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCACTACTACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAAC
TACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCGGCGAGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACT
TCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCTCCGTGGAGAACCTGCTGAGTTAAGTGGCTTGCCGACAAGTCTC
GACTTTGCATTGGATGTTGGAATGAATGGGTATTGCATCAGACCAGATAGTATCGCTCTCTGCGCGCGCTGGAGATAATACGATAGCAGTGTTATTCTAG
AAAAGTGCTGGCCCGATAATAATGTATCATTCGCTGTGTAGTGCCCGAAATAATGCGATGCTTTCATCGGTCATCATGAACTGGGAACCGTACAAGCAAT
ACAGCTGTGTTGTCTAATGCATTTGCAGCGAGCGAGCGCTGCCATTGTGCAGTGTGAAGCTGGTGGCACTGTATCTATCGGTGAGGAAGCTGCTTCAACT
ATCAGTACATCAGTTGTTGCATGCCTGTAAAGCTGCTTTTAGTCACCGCCGTCAACGCGCGGTGATACCAGTGCAGCACTCGCGCGTCGCTGAAGTCTAT
CCGCGGCAGGAGGAGGAGGAAGGGCAAGGCGAGAGCAAAGCCGCGTTGAAGCCGACGGCAACGCTACGAAGCGGTGGACACAATGAGGGTCCTTCAGTCC
GCCCCGTGCTCCATGGCGCGCGAAAGATTGGATCGGCTAGACGATGGTGAAACGAATCTGTCGTGGTCGTCGCTGTCGGCCAGCAGTTTGCAGCAGCGGT
TTGCAGCTCCCTGCAAGGGATTGAACTCTACTGGACACCAATTCCTGCAGCTCTCGGTTCGCAGTCATCAATGCACCCAGAAGACGTTGGGCTGTCGCCA
CTGGGGTACGGGCGCACGAACAACAGCCTACTGGCTGAAGCATGGTGCGCTCGCAACGCTGGCAAATCAGTCCCGCATGACATGAGACTCCTGACTCTCG
TGGGATCTCTTTCGTACAGCGAGGTAGCCACACAATGTCGGCGCACCACTCCAAACGGATTCATGCTGATCAAGCAGAGCGCGACGCCAATTAAAGCGCG
CGAGAGACTTGCAGGCGCCACAGCGTTAGCCCCATTAGCATATAATACTTACAGCAGACACACACGCTGGCCGAATATCCGCAGGCGAATCAAGTCAAGT
TCGGCATGGCGTTTTGGTGTTGCGGCGCCTACGTGTGACTCTGGCGTAAAGTATGTGGATCGGCTGGGCACCGATTCAGCGTGGGCATACAAAAAACAAG
ATGTCGAAGGCAAGTCACGAGAGTGGCACCTGAACACGAATACCACAGCGACAGGACGACCACCCACCCCGTCTAATTTTGTCCCTTTTAATTCAATATT
ACAGGTAAGTGACCTCCACATTATGCAAATAGTTACTACGTCTGTTGAAGCCGTCATTTCTGATGTCTTCAGAATCCCTTGCCATCATGAAAAATGCTAA
TTCGCAGGTCAACCGCGGGCAGTCATTTCGAGACAACTAGTTGCACTGACGTTGCAGGGCCCGCCAGCTGGCGATGGCGTCTATGGCCCAGGGGCGACTA
TTGCCTGAGATAAGCGCCCGTCGTCATGAAGCTGGCCACCTCGGCCCACGCCACGATGTGTATGGCATCCGTCTGTCTCCATTGCTGATCGAACCGATGC
GGACTTATCCAGGCACACGAGTCTGCAACGCAACACGATCCCATTCTGCAATTTGCCGACTTGGCCTCACATCCTCCGTCCCACAATGGTTAAGGTCTTC
CTCGCCCTGAGCGCCGCGCTGGTGATGGCCGCCCCCGTGGCCGCGTCCGTGTCCGTGAGCTTCGTGAACTCGTGCTCATACGCCATCAGTCTCTACGACA
ACAGCAAGACCGAGAGCATCGCGGCCGGCAGTTCAATGAGCCGCGACTTGGCCAGCGGCTACAACGGCATGTTCCGCGACGGCACCAGCGACGAGGCCAC
GCTGGCCGAGTTCTCCGTCACGGGCGGCTACACGTGGTACGACATCAGCGTCATCCCGCCCGGAAGCGGCAGCTGCTCGTCCTACGACGCGTGCAAGGAG
CTCACGGGCAAGTCCGGCTACAACGTGGCCCTGAGCATCGCGCCCGACACGAGCTCGACCAAGTCCGTCTCGAGCTCCTGCGCCACGCTCACGTGTGAGA
GCGAGGAGTGCTCCGACGCCTACCTGTACCCATCGGACGACAGCAAGACCCACAGCTGCCCGGACACGCTGCCCTTCACGGTGACCTTCTGCCCTGGCGG
CTCAAGCTCCAGCACAACCACAACCACAACCACGTCGTCGTCTGCGGCGCAACAGTCGAGTCAGTCGACCACCACGTCGGCCCCTACCGCCACGACCGCC
ACCCCGGAGGTGCAGAGCGACTACAAGTCGGGCACCGTCATCACGTCGTCGGGTAGCACCACGACGGCTCCGACCAGCACCACGGCAGCTCCGACCACGG
CTCCGTCGACCAGTCAGACCCAGACGCAGACGTCGACTTCGACCACTTCCACGTCGACGACCACGACGTCGACCGGCACCGCCGCGTCGTTCTCGAGCGC
GACCATCAGCTCCAGCTTCGCGTACACCGGCACTGATGCCGGTTCGGCTGCTGGCACGTACGGCAAGGTGACGGAGATGTCCTCCTGCACTACGGAGGAC
GTGTCTCTGACCGACCCCGTCGGCCCAATGAGCGAGGAGGTGAGTTTGGTCTTCCGTGGGCCCATGAGCATCTACAACATCGCCGTGTTCAACGCCAGCT
CTGGCAGCGACTGGAGCAAGGTGTCGGCCTACAGCCAGAACGGCACGCAGGACAACATGGTGTTCATGAACAACCTCAACATCGATTACACTGGTGCCGA
CTCGAGTCCTCAGGGCTACGCGACGGACGACGGCTCTGGGACTGCCACGAGCTCCACGGCGTTCGGCGGTTCCCTCGCCGACGCGTCGGACTCGTCGGTG
ACTGGTGGCGGTCCGTGCGTGTCCACGGGTTGTGAAGTCAACATCATGACTGAGACCAACTGCGCCGATGAAGATGGCTGCATTGGTTACTACGACGACA
TGGGCTTCCACGGCTGGGACGGCGGCATGAAGATGTTCGTGACCAAGGTGCAGATGCCCACGGGCGATTCCGTGAACCGCCCGGCCATTTGGATGCTGAA
CGCGCAGGTTGTGCGTGCGAACCAGTACGGCTGCAACTGCCGTGGCGAGGGCGCGGAGGGCGGCTGCGGTGAGCTTGACATCGCCGAGGTCATTGAGACC
AACACGGACAAGGACAAGGTCTCGACCCACTATTACTTCTACGACGGCAGCGTGTCTGCGGGCGGTGACAACTACGCCTCGCGCCCCACCGACTCGGCTG
TGACGTACGTGACCATCATCGACAACTCCAGCGATGGTTCCATCAAGATCATCGAGCTGGGCGGCGACGACTTTGACTTTGACGTGGACGCCGTGACGGC
CGACCAGGTGACGTCGTGGCTGTCCGCTTCCGTCGAGAACCTGCTGAGCTAAGCAGCTCCGAAGTGTCTGGCATCTGTAGCCGCGTAAGCTGAGCTCTGT
GGTGTGTTTGCAGTGCCGTGGCATGGCCCCTCGCTGGTTGCGACTAATAGATGAGGCGGTCATTGCTGTCTCTCTTTCGCTAGAAGCTCGCACGTAACTT
GATATCTATACAACGAGATTTTGACTACTCTCTTCGAATCACATCAACCGCACAATGATTGAGCCCCTTTGCTGCGGTAGTCGTAGTTTCTAGTACCGTT
TGCGTTGTCTTGCACTCTGTGGTCGGTGCTTCGCTATCGGATACCGGTGTAGCAAAAGGGATGGTACTTCTAAGCGTCCGCCGCACCTGGTATCGTCCCC
ACACCAAAGTTATTTGATGATAGTGCTGATTGAGCAGCCTTGCCAGGCGTGTAACCCGTTATCTCCTTGTACTGCTTCACCGTCGCCAATGCGCGATCGC
CGTTCACCGAATCGAACAGACCACTCGTATCCACGACGTTGGCCGAACAAGCTCGGCCCAGCGACGCACTACAGTCGTCCGCCGTCGAAATACTCGCCTT
GGCTGGTTCGGCCAGCATGGGTTCCGCCGTGTCTTCGAAGAAGTTACGCACAACCATGCAAAGATTATTTCCCCGAAGGGCGTCCTATAGGTATTTAGCT
TACAGAGTCTGAAAGGGTTCATGCCTGAGCCGGCTACCACCATGCAACCTTCCCCACCTCCAGATAGGCACACGGCGACACAAGGAAACTTTTCTGCTTA
CGTCTTGTCTTGAAGAAAACTTGGACGGTGCGCAGTTTCGTCATGCAGGTCGCGTGACGTGACATCCGTTGAGCAGCTCTCGAGTCGACGCAGCATTCTC
CTCCAGCCTTACGTCCGCGCTGGGAGGTCCACCAAGAATTATTTTAAATGTGGCGGGTAGCTCCTCAGCAGCGAACAGCGGGCTGTCGGGACTCCTTTAG
CAATCTTCTTCCTCCTCCGCATCCTCGCCTCCCGCGGAGGCCGGCGCTTGTGCGGACGAGTGCGCTTGACGGAGCGAAATGAAAAGTGAGAGCTTGCTGC
AGCAGTGAAGTACCCAACAACACCGTCGAGAACACCGTCGAATTGGATGCAGGCGCTGGATCATGACAACAATGTTGGAGTGCGTACATGCAGCAGGACA
ATGCGTGCGGCCAGCAATGGTTAGACTTGACAGAACTGCCACCATGTCTGGACTGGGCAGCAGCTCTCACTTTTGATTTTGATCATACATTTCGGCAAGA
AACCCGGGAGCAGGCCAGCTCCCCTCGCTAGTGTTTTACACTTGCCTACACTGTGAAATATACGAGAGTTCATCAAACAATAGCCGACATTCACGTCAGA
CTTGTCGTACCCTCCGAACATCGGTGAATGAGTCTATTTGAAATTCCTGGTAGACTCTGAAGTAATTTCAGAAACATTATAATATTTTAAAAAACAGCAG
TTTCGCTCCATCCTAAAGTTACTTTACTAAAATGTAATATCAGTACTATCTCATTTGTTTTTGACTCGAATGAGAGGCTACGAGCGCGAGCGTAGTTGCT
AATGACCATAGTGGAGGTCACCCCACGAGTGAATGGTACATTACATAGGACCACTTGAGCAATTTTCCGTACCTTGCGCTCAGTTAGTAGCACAAGGCCA
CCAACAGACTTGTCCACCTTAAACCACGGTAAGTTTGCTCATTCTCCACGCCCTTCATTAAGTGCAATAGCCTCTGTTGTTCGGCGTATGAAGTGAGCCA
ACCCACCTGCTCGTACGCCAAGCTGACTGTGACGACCCGTGTGTGGCCTGTGGCCGTGACGTCCTTCACTTTTGCAGTAATGAGCTGGATGACTTCAGTT
GTTCGTGTCTGTATTGCCCGTGGTGGCGATATGTTCTGCTAGTGGCACCCGTACTTTCGGTTTATCGTGATCAAAGAGTCTTGTGGAGGAGGCGCGCTAG
AAGAGAGGTGTCGCCCCCCCGCGGTTCGGGCAGGCGGAAGCTTCTAGAAGCTTCCACAGCTGCCGTACGTCTGCCTACTTGTATTCACGTAAGTTTACTA
TATCATACTAAACTTCAATGTCTGCACTACTGTTTCAAATCGGCTAGCACCCACCCTTCTATCTGGCCGCGCGCCCCTCTGGCTTCAGCATTTCCCCACT
GAGATCGCTTCGCGTCGTCGCTGCTACTGAGGATTCGTCTGACCCTCCTGCCCCATGCTGCTTACCGGGCGGCCGATTCTTGAGGGCTTGAATAGGTCTC
TCGGTTGACGTTGCCTTCTCCCTGCGATGCTTCGTGCTGGAATGGCGTCGCCTCCTCGAGACGATGTGGAGCCTGCTGTGCCTGCCTCACCACCTGATAC
GTTTCCTGCTCAGCTGGCACTTCCCCACGCACCTGTAAAATTCACCTGTGGTTGTTCTTGATGAAGATGGCGACCCGGACTCAGATATCGACGCCGATGA
CGCTGTGCTTTGGATTGCCATGCTTCGCAGGATTGTGATGAAGCAAATTCTCGAGCAGCTCAAGGCTGAGAGACCAAATGAGGACCATGGTAGCGAGAGG
GACGGCGCTTACACCACCCACGCTATGCACCAAGCTTTGCAGAAGCACTGAAAACAGCTTGTGTTCATGAACAAGATATTCAAGTGCAAGAGCGACAAGC
TTGTCAAGAATGCCATCAGGTGCAAGAAGCATGCTCTCTTCATTATTGGACGGCACCCTGGACAGCAGGAGGGTTCTTGGCATTGTATTGCCAGAGCCAC
TGTCGGTAAGAAAAACCTCTTCATTGAGTCCGACAGCTACATGTATTTTCCTAATACTGTAGAGAAGCTTAGCTCATACTTTGAGCACGTTGACGGCGTG
TACGTTATCGAGGATATTGTGCAGTACGGAGTACCCAATAACTGGTACAATATATTTCCTTTCACTTGATTGCTTGTTTAAATACTCTTGATTATTGCAA
TTAATGTAGTGTGGTTAACATGAAACGATGAGTGATTGCACATAATTATTACGCTAATTTTTGTAGAAGGGTTAATACCTTTTTAGAAAGGCCATTACGC
AGGCGTAGAAAAGTCGGCTTTGCAGGTGACTTGGCGAATATATCTTCCACCATTTCCTTAGTGCTACAATATTTCATCTTCGCTCTACATTTTCTTGTAC
GAAGCAGTAGCGAATAAGGATATGATTGCTTCTATCATGAAGTTCTGGATTATATGAGAGTTTAATACAGCTCTGGTTGTCGTCGTAGAGAGTGATGACA
TGTGGGCTACTGTGGTCTAGCACTATCAGTAGGAGTTTTGAGAAGATGACTTCCTGCATGCAGTGGCATAGTGCGACGTATTCTGCTTCAGTTGTGGATA
GCACGACTGTGTGGTGTTTCCTAGACTGCCATGAGATTGGATTGCCACTTATGTAGGTAATATGTCCTCCTACATATCGACATTTTTCGGCGCAGTTATC
ATAGTCTGCATCAGAAAAAGCTGTGAAGTAGCGCTTTGTGTTATATTGCTCCAGGTTTTCCTTTCCTCCAAGGATAATGCCGAGGTTGCGTGTACTATTT
AGGTATCCACGGCTTCTCTAAACCGCATTTCAGTGTTGTTTTCCTGGATTAGCCAGAAATTGATTAGCTTCACGTAGAAAATAGGCTAGGTCTGCCCATC
ACCAGGTACATGAAGCTACCAACCGCCTTTCTGTACGGAATCGCCTTCATCTCATCGTGTTCCAAAGGAGTTTGTGGGCACATATCTAGAGAGAGTTTGA
TAGTCAGATCAGTGGGTGTTTCCACTGGATATGAGTTTAGATGGGAGAAGCGGTCCAGGACTTTGGTAGCGTATTTCTCTAGGTAGATGGAGCGATTTTT
TACGATCGCGTACAATGGACCACCCTAAGAGGTAATGGGCTTCACCCAGGTTGGACATTTTGAAGCGCTGTTTGAGTGCGTCCTTGATATAAGTGACAAT
GTCAACTGTGGGTGCAATGATGAGAAGGTCGTCGACGTAGACAGGAATGTAACATGTCTATCCGTCATTTTCCCCTACAAAGATGCTACTTCATCGTAGC
TAAGTTGTCAAGTGCCAGATTCGAGGGGCTTGTTTAAGGCCGTATAGACTCTTCACCAGATCGCATACGAAGTGTTCTTCACATCGGCGAAAGAACCATT
CAGGTTGTTCCAGGCATATTTCCTCATCTAATGGAGCAGCGATGGTAAGAAGCAGTCGTAGGACTTCCATGCGGATGACAGGGGAGGAAATCTCGTCGTA
GTCAATC