Description :
From Genome Similarity Track
Location :
Scaffold_69:53443- 60357
Transcript NameFunction/comments
Physo_139003hypothetical protein
Physo_159087PsAvh124
Physo_139004hypothetical protein

Sequence
6914 bases(100 bases per row)
CGCATACCTGCGAGCAGACCTCGATCGACCCATCTACATGCGCGCCGCTGTCGGACTCCAATTACCCAAGGGCAAATGCCTACTGCTGCGAAAGAGTCTC
TACGGCCTTAAACAGAGCGGCAAGTTGTGGAACGACACTATACACCGCTACTTACTGGAATTTGGCTTCAGGAGGAGCCAGCTTGACCCGTGCTTGTATT
TTCGTTGGCATGAAGGTAAGCTAACTGTACTGGGCCTCTACGTCGATGATGTGGTGGTCGTCAGCCAGCGTGAGGGCGATTCCGACTGGACGATGCAGAA
GCTCGCCGACCAATTTCAGATCAAGGACATGGGTCCAGCCAAGAAGAGCTTGGGAATTAACATTGAGCAGAGCGACTGCGGCATCTACCTCCACCAGACA
GCCAATATTGACGGTTTGCTGGCGAAGTGCGGCATGGAGAATAGCCGCCCCGTGACTACGCCGATGGAGTCAACTCGGGATCTGAACGGAGAGGACAGCG
AGCCCTTCTACGACACTAGCATCATGCGGGAGACCATTGGGTCACTACTATGGATTAGCAACTACACTCGACCAGACATCACGATGCCTGTGAACTTCCT
GGCGCGTTTCGTCTCAACGCCTACGTCGACTCATCGGACTGCAGTCAAACGTATCCTGCGCTACTTGCGCGGCTCGCGCGAGCTGAGGTTGCGCTTTTCC
CGCCCGCAGACACCCCGACACACTATTGAGGCAGCCATCTTCAGCGATGCAGATTGGGCCGGGGGCAAGGACACAAAGTCGACTTCAGGAGGACTGCTCA
CCATCAACGCCATGCCCATTTCGTGGTACAGCAAGAAACAATCTACGGTCGCCCTCTCTACAGCCGAGGCTGAGTACATCGCTGGGGCGACGGCAGTGCA
GGACTGCTTGTGGGTGAAACAGCTCCTGAATGAACTTGAGCTGCACAGCAAAGATGATACTATCGAATTGTACATCGACAACCAGAGCGCGATCAAAACA
TGGAGAACGACGTGACGACTGCACGCATGAAGCACAGCAACATAAAATTTCACTTCATACGCGACGCCATTCGCAAGAAGGAGGTCAGCGTGACCTATTG
CCCTACGACTGAGATGAAGGCCGACATTTTCACGAAGCCCCTCGGCGCAACCCTACACGGGCCCAACCTGGCCATGATCAAGCTTATCCACCCGCACAAC
GAGAAGCTGTAGACTCGGATCATCTTGGTCGAGGAGGGCTGTTGGAGATCGCAAGAGCTGGCGCCACCTGCGATGAGTGCAGTGGCGACGATAACGGCCT
GCGACGACCACAACGACCCCTCCAGCTACACAACACGAAACTACCGATGCATATTAGCCTAGCACAGACATCCTAGCATCATCCAACCTAACTCATTCTG
CAATACACCAGGTGCGAGGCACCACTACAAGGAGCAACCCGTGCAGGATCAACGAGTGCTCCCTTCATGCCTGCTTGGTACTGCATGCACATACAAGCTG
ACGTGACGCAAAGCTCAACAGGTGTGATTGAAGCAGGCTTTGCGGCATTGCGGTATTGCGGTTATAAATTAAAACGTAACATAATGCAGATAGAGATAGC
ATCACACCAACAAATTTACCTCTATCGTAAGGACCAGTCTGTTGATGTGATGGTTAGCAGGTTATTGCAGTCATGATGTCCTAAGTTCGAGGTATTCATT
TCCGATTCGACCATTACACACCCAAGCCCCTGCGAAGCTTCTCTCAACAATGCGCCAGGCATATTTCCTGCTCCTGCTCCTAGCCGTATTGGCCATTGCC
CAAGTTGCCTGCGAGGGGACTGGTTTCGAGCGCTTCATCGCCGACGATAGCGCGCATCGCAATCTCAAAGGTGCCGACACCGACACGGAAGAACGGTGGG
GTATTACAGGTCTCTTGAATCTGAAGTCACTATTCAGGAAAACCCCAAACGTTGCCAAAGCGCTCCAGAAGGATCCAGGCCTCGCTAAGACCATCAATGA
CCCGACCATTAGCAAAACCCTCAAAACTGTGGCAAGCGATCCCGCTGTGGTGAAGAGCTTGAATAAGCTGAGAGTTCCCCAAACCTTGAGACAGCGCTGG
TGAAGAGCTCTGGCAAGATTACCGAAGAGTCGGTGAAAAAAGCGGGAGCGCTGGTGGCAAAGGATGCTGGAAAGTGGACCGACGAAGGGACGCTGGTGGT
ATGCCTCGGTTTGCTTGCGCTCTTCGTTTTCGTGGCAAACCCTATCATTTTGATGGGTACGGTCTTCAACAAGTCCGAGTAGGTTAAACATTTTACTGGA
ACAGCCGTATTTACCGATAGGTGAGTCTGCAGACGCTTATGTTGAGCTAATCGACCTTTTTGTGGTAGGAGAAACCTCAGCAAAGACATGGTCTCAAAAT
TGAACACTACGTTGAGTTCACTTGACTTTCGTTTGACTTTCGTCAACAACATTTGTTTGTCTCAGCTTTACTATTCGAGTGGTGGAGCAATCCAATACTG
GATGAAAAGGACTATCTGGGCTCTGTCGGCATAATAGCGTGAGCGCTCTAGAAAAGATCTTAACTCAAGAAAAAATACAATCTATAACTGAGTGTCGAAG
ATAGTTCGATGATTACCGATAACTGACTGCAGTGCGCTCTGGCTGGTAGGCAATTTCAATCGATGAATTATAAAAAAAAACGTATTTTTAAACAGATAGC
AAGCGGCAACTAAATAGCTCTATAAATGCAACAGCTCCGCATACAACTTGCCACGCGCGCCGGCTCAATGCAGCTAATTACGGGGTTTCCACTGTAGTTG
ATCAATGTCGCGGCCGCAGCTGTCAGTCGCATTTAACACTTCGGGTCTTCCACTGAAAAGCTGCTTACAAATCCGTTCCATGATGCGCTTCTTTGGTGTG
ATACCTCCAAAGCGTTCTTCAACACGTCCAGAGGCCAGTCCTTTGATTCGCCCCTTGTCAGTATTTGCAGCAATTCAATCTGATCATGCGTCGCAGCGCT
GACAAACATGCCGTCTCGAGTATCTTGTGGTACATCCGGCCGGGTTGATACTCCGTTGGCAATTGTTCCAGCAACATGGACACACTCCGCATGTAGAGCA
CTTTGGAATGCCACGAGCAACGTACTGGCAGATACGCGCTCATCATTGTACATAGATGGAAGTATCCTCCATTTACCCTGGGCTGCCGCTTGTGTGAACG
CGCCATTTAGTGTGTCGGAAGTCAAGCGAGTGTCGCCTCGAAGAAACTCGGTAAGATCCTTACGGCTGTGCTCCACTGGAGCCACGAAAGCCTCATGAAT
CATTTCAGAGGAAATTCATCGGAGCTTATGGAAGATCATCACGATCTCAGTATTGTCAGAGGATGCTGAGTTACGAAACGCAGCCACGACCAATTCATCC
GAGACGTCACACTTTTCGCATAAAACTTTGAGCGCGATGGCTGTACAACTTGCACCTTGAAAAACTTGACTAATCACCGAGGCCGATGCACGCTTCGCAT
CGACGAGGGTTTCCAACACTTTAATGTGGCCAAAGTGACTAGCGGCCTCCAGAAAGGCCAAATCAAAGACATCCGACGAGATGTAGCCAAGAATCGAACC
GTGTGATCCTTCCCCCACGACACTGCCGACTCAAATGCAGCGGTCACCAACGCGACGTCGTTGTAACCTGCGTTATAGAGGTATTCTACAGTATCTGCAC
TACCCGTTCGTGCCACCTCTCGAAACAGATGCGTGGGGTCTTTGTCGTAAATTCTTTGCACCAGTTCACTCTGCCCCAAAGCGATCGCTGCTTCACAAGG
TTTCGCCATATCCCACGCATACTCGTCCTGATGGAGCAAAAAGTTAACAACAGGACCGTGACCACTCGTAATCGCACAATATCGTGCGTCTACTTCACTT
TCCGGATACTGCAGGCACTCGAAGTTTCTTTCCACCATGAATTCCACCACTTCGAGGCGACCATTTCCTGCAGCTTCTTCCAGTAGTTGACACAGAGCGA
CCTTCAGTTTTCGGCGCAACCGGGGCAATTCAGGATCGACTTCTTCGGGAATCAAGAACTCATATGAGCGTTCTTTGCGGCCACTTGTGCCATTTCCAGC
AATCTGTCAAAAATTAACGATGTCGATCTCGCCTCTATAGTCGAAGAAGTTGGAGGCCAAAAGCTCCACCATTTCGAAATGGCCATTTGCAGCGGCAACT
TGAGCTATCGAGTCGATATCTTGGAAATAGTCGGAGTGGAGCAGCAACTCCTCCATCCAGTCCAAGTCTCCGCTCCCTGCAGCCTCCGAAGCAGCTTCGT
CTGGAGTCATGAGGAACAGATCGATCTTCTGAAGGACACAACGCAGAGCTATAATAGCGGGTGGGAACTCAACGTTCTTGAATCTGTAGAATGGGTGGAT
GCATTTTTCCTTGATCTCCCCTGAAGCGGACCACTCGCGCTAGGTTTGTTTTTCTTGTAGTGACGCAGAACTTCCACGCGTCCTCTTGCTGGGCGCACTC
GAGCCCTCCATGCTAAAACGACCCTTCGATTGAGTTTCCGGACTGTTGTTTGCTTAAGTATTTTCGCCGTTAGCAAAAAATAATAATATAAGCAGCGCAG
GATCTTAGAGCATCACATGAAAAATACCTGCATTACTCCATTATGACTACATAAGTCCACAGTGACATGAGAAGTAAGCGAAACAAGTGCTAGTGCCCGC
ACGCATGCACCTCAATAAAAACAATATCTCCGTAATTCGTCATTACCAGGATCGACCCTTCAAGCTGATGGTCATTCCACAAAATGGCCAGTCCAAGTCA
AGCACCTCCCGCCAAGCGCTTGTGTACGACCGGCGCAGGCGACAACGCATCCCAGCGCAACTCCCAACGAAATCCAAGCCTCCGCTCGCAAATCCCCCAC
ATCAAGAGCGAGGCGCTGACCCCAGAGCAAGCCGTGATCCAGGCCCTGCAATCGAGAGACTCCCAACGGCTGGCGGATCTGAAGACGAAGTTCAAAGGGG
TTATTAAAAACGCCTTCATGTTTGCAGCGATCACTGGGGACTTGAATACGGTCCGGCTGCTGCTGCGAACGGAACTCGAGGAGCCGGAGCGCGATTTAGC
CAGTCCGAAACTGTGCCGCCTCCTCCGGAAAGCGGTACTGCCCGCTGCCTCTAATGGCCACCTCCCAGTCGTCGAGTATCTGCTGCATGAGCTGCAAGTC
GAAGGGGAAATCGATGACGACGCGGCGTGGAGTGTTTTCAATGAGGCCGCGGTGAAGGGGCATTTAGGGATCGTGAAATTTGTCGCGGAATACGTTGAGG
AGGAGGAGTTTGAGCACAAGTCGTGCGAGGTCATGAACAGTGCAATCGTCGGTGGCCATGCCAACGTGATTACGTTCCTACTTGGCTGCGAGATGGGCGA
TGTTTTCGACATCGGCGATGTATTCGAGGAGGTCATCGCCCGAGGTCAGGATGCAGTTGCTGATGAGATTTATAAAGACTATTCAGACACCAAGGATGGA
CAGAGCTTACTGGCCCGCTTGGCTGGAGCGGGGCGCCTCAAAGCAGTCGAACACTTGGTAACGCATGGGCATAACGAGCCCGATTTGATTGAATGCGGCT
TTATGAGCGCAGCTATGAGCCGGCATGACGATGTCTGCAAGTACTTGCTGAGAACTGGCCGTGTGTCGACAGCAGGCTTTGACGCGGTGTTCCTGAGTGT
TGCAGGATCTGGATCGATCAAAGGGACGATGAGTCTATACAACATGCGTCGTCCTACACAAATGGGGATCGAAATGGCATTCCAAGCTGCGGGCAGCTAC
GAGGTTGCCGAGTTCATCTTCGAGAACGAGCATGTGCCCGAGATGGCGATCATTATGGCGTTCAAGAACGCCTTCAGTCTTGAATCCAGGATCAACATGC
CGACGAAAGAGCGTGAAAGTGTTGCAAGGTTTCTATACAGTATGGAGTGCGTCCCACCAGAGATCGTTGGCGAAGTTTTCTCGTACACTTCATTCGACAT
GATCGAGTTTCTCGAATTTGGCTTCGACCGACAGATTTTTCCTCCCTGTGCAATCAGCGACGCGTTCAAGAACGCGGCGGAGAACGGCCTGACGAAGATC
CTCAAGTGTCTGCTCAGAAAAGCAGGTATCCCGCAGGCTGTGAAGGAGGAATCGTTTGTTCGTGCAGCTCTTAACAACCACAACGCCGCTGTGCAACTCA
TGGGTGGTGACAGTGACTGGCCACTCAGCACGTTGACTGAGGCTTTGAAGCTGACAAGCAACCCCACCTTGAAGGGCTTCTTGCGCACGAAGGTGCAAGC
TGCCCGTGCTGGATGAAGTGGAACTGTCCTCAAGCTGCCCGACAAGCATCGAGGTAGCGTTTTAACTTTTACGACTTCTTCGAGTTTGCCTTCAACTCAA
ACGTTGAAATTAATTTAGTTTTTTTCTTCTTCTTACATCAACAGACTCACTACACCCGAGATGACGATGGCCGGAACTAGTAGAGAGGAAGTCTGCAGTG
AAAAGAGTTGTAGCATTTCCACCCCCGCGACCAAGTGGAGATCTAGGATCTCATGTCTCGGGGTGGATACGGAGGAGTTTGCAGGTTGGTCTACAGCCAC
GAAGCTTGAAAGTGAACAGATCAAATTCACGGCTGACCTCTCACGACGAGCAAGGCTATCCTTACGGGCTCGATAGCAACATACTCCACATCGTCTACCA
CGCCGCATATTTGCACCCATGAACCTTCACTTGCTGTCTTCGGTGGTGATTCACCGCGACATGGAGTCCAAGAACGTAAGAACGTGCTTTTGGCGGAGAA
TCTGACGGCCAAACTGACCGAGTTCTGAGCCTTTGCCAACCATGCCGTCGAGCTTCGTGAGTTGAACACCGCACACTACAATATGGCCTGAGTAGGAGTC
GTCAGTTGTGCGGT