Description :
From Genome Similarity Track
Location :
contig_5:534320- 538352
Transcript NameFunction/comments
g1728.t1hypothetical protein

Sequence
4032 bases(100 bases per row)
GCGCGCGTTCTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTCTCGAGTTTGCAG
GGATCGAACTCTCGCATCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGGCTAGAGGGATGC
ACAGCCAGCAATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAATTCCGCTGGATGA
GAAGATCGATTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACGCTGTCGGGACTG
GTCAAGATCCTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGCTGGCTGAATCGA
CTTTCAGAGAGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTGCCACGATCACGTGTGAGCAATTTCGGGAATTTTG
TGCTAAGAACAAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGACCGGGAGGATTCA
ATGGAGAGTACTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCACTCAGAGTCGTCGGACTCATCAATAGTCGTGGATACACCGATGGATGTTATGCTTG
ATGACGTCGGTGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCCGATTTCTAGAGGAGCCCCACTGATCTC
AGTCCAGCTAGACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGCCGGTGGCAGAGCTGGACGCTCCGAA
GAGATTGTATACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATGTGTTGAGTTTAT
GTCTGCATCCCCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATTGTGTGGGATTTAGACACAATGGAGACCCAATGCATTTT
GCAAGGGTTTCACAAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGCATTGCAATCTAC
GAGTCATCCAGCAATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGAGGACACCTAACG
AGTTTGTTACGTGTGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAAAGGATCTCTGCA
ACCGTTTCCCGTGGCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCTCGGCAATTGACA
TCCGTCATTAAGGCACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCGCTCAATGGGATG
ATAAGCTCAAACAAGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTGTTGTTATTCGCC
TGATAGACGAACTATCGTCGTTGGGACACTAGCGTCAGAGATTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCACTCACTAAAGGAC
ACTTTCAAGGCGAACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTTGGGACTTAGCAAT
GCAGCATGAGTTGGGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCTTGGCACGGAGGAA
TCTGGCAAGACTGGAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTACAGTGCGATGGATT
TAACCTGTGCAAAGGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCGCAAGCCACGATTC
CAAAATCTATCTGTACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTTCTCACTGGACGGG
AACTACTTACAGAGCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTTCGGGACGAATTAT
GGCACACTATGACCTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATCGATCTAACAACGG
AAAGCTGTTGGCAACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCTGCGTGGGCATGCT
TCTCACGTCACGAACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAACATGACCAGCAGC
CCACAATGGAAGACGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTGAAGACCCTTTGGA
GGTCGTGGCTACGAGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGCTTCGCTGAAAGTG
GACAACACGTCTCCGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGATTCCAACGGCAAGG
TTGTATATCATACTGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCGTCGCATTGTGTCC
TCATCCGAATGGTACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATATGTCTGGGACTCAGTGAGCGGAGCAGCTGTAGCTCCCTGTCTG
GAAGGATTTCATCAGCGTTTTGTAAATGTTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCATTCCATTGCAATTT
ACGCTTGGCAGAGTGGTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGGAGTGGGTGACATG
TGGTGACAAACATATTCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAATGGAAAGGTTCCG
TCCGTCTTTGACTGTGTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTTGATTTGACAAAGG
CAGTACCGGCACATGACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCGTTTGGGATGCCCA
GCTAAATAAAGTGGCTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTCTAACCGAGTTTCT
CCTAGAGTTTTCTTAGTTGGAACTGGCGGGAGCGATCTACTTGAGCTCGATGCTGGCCGCGCTCAACCAACTTTGTCTACAATCACACGCGGACATTTCA
AAATGGAGGTCTGGGGTCTTGCGTGCCACCCA