Description :
From Genome Similarity Track
Location :
contig_5:534273- 538306
Transcript NameFunction/comments
g1604.t1hypothetical protein

Sequence
4033 bases(100 bases per row)
CGCGTCCGTCAAGGACCGCCAGGCGGTGGCACTGGCCGATGCCATCCTCCCCTTTGACAACCTGCGGCTGCGCGAGATCGAGGCGTTCTGGCGCGCGTTC
TACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTCTCGAGTTTGCAGGGATCGAACT
CTCGCGTCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGGCTAGAGGGATGCACAGCCAGCA
ATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAATTCCGCTGGATGAGAAGATCGAT
TTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACGCTGTCGGGACTGGTCAAGATCC
TTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGCTGGCTGAATCGACTTTCAGAGA
GATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGGCTGCCACGATCACATGTGAGCAATTTCGGGAATTTTGTGCTAAGAAC
AAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGACCGGGAGGATTCAATGGAGAGTA
CTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCACTCAGTGTCGTCGGACTCGTCAATAGTCGTGGATACACCGATGGATGTTATGCTTGATGACGTCGG
TGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCCGATTTCTAGAGGAGCCCCACTGATCTCAGTCCAGCTA
GACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGTCGGTGGCAGAGCTGGACGCTCCGAAGAGATTGTAT
ACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATGTGTTGAGTTTATGTCTGCATCC
CCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATTGTGTGGGATTTAGACACAATGGAGACCCAATGCATTTTGCAAGGGTTT
CACAAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGCATTGCAATCTACGAGTCATCCA
GCAATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGAGGACACCTAACGAGTTTGTTAC
GTGTGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAAAGGATCTCTGCAACCGTTTCCC
GTGGCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCTCGGCAATTGACATCCGTCATTA
AGGCACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCGCTCAATGGGATGATAAGCTCAA
ACAAGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTGTTGTTATTCGCCTGATAGACGA
ACTATCGTCGTTGGGACACTAGCGTCAGAGATTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCACTCACTAAAGGACACTTTCAAGG
CGAACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTTGGGACTTAGCAATGCAGCATGAG
TTGGGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCTTGGCACGGAGGAATCTGGCAAGA
CTGGAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTACAGTGCGATGGATTTAACCTGTGC
AAAGGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCGCAAGCCACGATTCCAAAATCTAT
CTGTACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTTCTCACTGGACGGGAACTACTTAC
AGAGCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTTCGGGACGAATTATGGCACACTAT
GACCTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATCGATCTAACAACGGAAAGCTGTTG
GCAACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCTGCGTGGGCATGCTTCTCACGTCA
CGAACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAACATGACCAGCAGCCCACAATGGA
AGACGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTGAAGACCCTTTGGAGGTCGTGGCT
ACGAGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGCTTCGCTGAAAGTGGACAACACGT
CTCCGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGATTCCAACGGCAAGGTTGTATATCA
TACTGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCGTCGCATTGTGTCCTCATCCGAAT
GGTACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATATGTCTGGGACTCAGTGAGCGGAGCAGCTGTAGCTCCCTGTCTGGAAGGATTTC
ATCAGCGTTTTGTAAATGCTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCATTCCATTGCAATTTACGCTTGGCA
GAGTGGTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGGAGTGGGTGACATGTGGTGACAAA
CATATTCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAATGGAAAGGTTCCGTCCGTCTTTG
ACTGTGTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTTGATTTGACAAAGGCAGTACCGGC
ACATGACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCGTTTGGGATGCCCAGCTAAATAAA
GTGGCTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTCTAACCGAGTTTCTCCTAGAGTTT
TCTTAGTTGGAACTGGCGGGAGCGATCTACTTG