Description :
From Genome Similarity Track
Location :
contig_5:534208- 541354
Transcript NameFunction/comments
g1728.t1hypothetical protein

Sequence
7146 bases(100 bases per row)
ACATGGGCAACGCGCTGCTGGTCGCGTCCGTCAAGGACCGCCAGGCGGTGGCACTGGCCGATGCCATCCTCCCCTTTGACAACCTGCGGCTGCGCGAGAT
CGAGGCGTTCTGGCGCGCGTTCTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTC
TCGAGTTTGCAGGGATCGAACTCTCGCATCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGG
CTAGAGGGATGCACAGCCAGCAATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAAT
TCCGCTGGATGAGAAGATCGATTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACG
CTGTCGGGACTGGTCAAGATCCTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGC
TGGCTGAATCGACTTTCAGAGAGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTGCCACGATCACGTGTGAGCAATT
TCGGGAATTTTGTGCTAAGAACAAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGAC
CGGGAGGATTCAATGGAGAGTACTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCACTCAGAGTCGTCGGACTCATCAATAGTCGTGGATACACCGATGG
ATGTTATGCTTGATGACGTCGGTGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCCGATTTCTAGAGGAGC
CCCACTGATCTCAGTCCAGCTAGACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGCCGGTGGCAGAGCT
GGACGCTCCGAAGAGATTGTATACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATG
TGTTGAGTTTATGTCTGCATCCCCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATTGTGTGGGATTTAGACACAATGGAGAC
CCAATGCATTTTGCAAGGGTTTCACAAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGC
ATTGCAATCTACGAGTCATCCAGCAATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGA
GGACACCTAACGAGTTTGTTACGTGTGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAA
AGGATCTCTGCAACCGTTTCCCGTGGCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCT
CGGCAATTGACATCCGTCATTAAGGCACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCG
CTCAATGGGATGATAAGCTCAAACAAGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTG
TTGTTATTCGCCTGATAGACGAACTATCGTCGTTGGGACACTAGCGTCAGAGATTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCAC
TCACTAAAGGACACTTTCAAGGCGAACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTTG
GGACTTAGCAATGCAGCATGAGTTGGGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCTT
GGCACGGAGGAATCTGGCAAGACTGGAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTACA
GTGCGATGGATTTAACCTGTGCAAAGGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCGC
AAGCCACGATTCCAAAATCTATCTGTACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTTC
TCACTGGACGGGAACTACTTACAGAGCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTTC
GGGACGAATTATGGCACACTATGACCTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATCG
ATCTAACAACGGAAAGCTGTTGGCAACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCTG
CGTGGGCATGCTTCTCACGTCACGAACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAAC
ATGACCAGCAGCCCACAATGGAAGACGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTGA
AGACCCTTTGGAGGTCGTGGCTACGAGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGCT
TCGCTGAAAGTGGACAACACGTCTCCGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGATT
CCAACGGCAAGGTTGTATATCATACTGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCGT
CGCATTGTGTCCTCATCCGAATGGTACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATATGTCTGGGACTCAGTGAGCGGAGCAGCTGTA
GCTCCCTGTCTGGAAGGATTTCATCAGCGTTTTGTAAATGTTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCATT
CCATTGCAATTTACGCTTGGCAGAGTGGTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGGA
GTGGGTGACATGTGGTGACAAACATATTCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAAT
GGAAAGGTTCCGTCCGTCTTTGACTGTGTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTTG
ATTTGACAAAGGCAGTACCGGCACATGACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCGT
TTGGGATGCCCAGCTAAATAAAGTGGCTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTCT
AACCGAGTTTCTCCTAGAGTTTTCTTAGTTGGAACTGGCGGGAGCGATCTACTTGAGCTCGATGCTGGCCGCGCTCAACCAACTTTGTCTACAATCACAC
GCGGACATTTCAAAATGGAGGTCTGGGGTCTTGCGTGCCACCCAACCAAACCTGAATACTGCACTGTCGGCGATGACCAAACTATTCGAGTGTGGTGCCT
CGCTAAGAAAATTCAGCTAAGGGTGCAGAGGCTTGAGTGCGTAGCTCGAGCCTGTGCATTAACGGGCTCAGCCGACATTGTCGCGATAGGATTCGGTGGG
CGCAATGCGGTGACTGGTCTATCAAAAGCTGCCCAAGCAAAAACAGGAGGTATTGTTTTACTGAGCTACAGTGACTTGACGAAAAAGGTGTTTGAAGATC
GCCCTTCCAAGCAAGCTATCAGCGAGATGAAGTTCTCGCCGAGTGGTTCCGTTCTTGCCGTTGGGTCGCATGATCATAAGATCTACCTGTATCGCCTTGA
TCGGAATACCACCAAAATCACCAAAGCATCAGCTTTCGACAAGCATCAAAGCTACATAACTCACCTTGACTTCTCAGCGGATGGTCAAGTGTTACAAAGT
AATTGCGGCGCCTACGAACTTCTTTTCAGTAATGCTACCACAGGTAAGCATATCACATCTGCGAGCAGCACGAAGGATACTCAGTGGCATTCGTGGACAT
GCGTGCTTGGGTGGCCCGTGCAAGGCATTTGGCCGCCGTGTTCCGATGGCACTGATGTGAACGCAGTCGCTCGCAATTCACGCGAAGACCTACTGGTAAC
CTCGGATGATTTTGGCCTGGTCAAGCTTTATCGGTATCCATGCGTCGCTAAGAATGCGAGCTCCATAGATCATCGCGGGCACTCGTCCCATGTGACCAAC
GTCCGGTGGGCTCTTGACGATAGCTATGTGATCAGCATTGGCGGAAATGATCGCTCCGTGATGGAGTGGAGGGTCTTAGGGCAAAATGAACGGGTTCCAG
CGGCGGGATCTGAAAAGAAATTGAGCTTTGTTGAGGCAGAGGAAGTCACGGATTCGTCTGCTGAATCGGAAGAGGAATCGTTTGATGAACCTGCGGGGGA
CGAGTTTATGGCAGTAAAACCTTGGGTTGGAGCGATTGTTGCACCCACGAACGCTGCCACGCCTAACTCTCGTGAGCCCGAATTGAATGTTGAGCTTGAA
TGGGTGTACGGTTATCAATCGGAACTATCACAGCAAAACCTAGCGTACAATGCGCAAGATGAAATTGTCTACCACACTGCTGCGGTGGGAATCATCTACG
ACTCTGCAAACCATCTCCAAAAACACCACGTTGGGCATAACGACGACATTATCAGTTTCGCGCTTTGTGACGCCAAACGCAACCTCATAGCAACAGGAGA
GAGGGGAAAGAAGCCTTCACTAAGGGTATGGGATGCCCACACAGGTGAATTACGATGCGAGCTGAAGGATGCTCATACTCGCGGCATTTTGTCGCTTGCG
TTCAGCAATGACTCGACAAGGCTTGTCAGCGTAGGGGCAGATGATGACCACTCACTGGCAGTTTGGAGTGATGCCAGTAATGGATCATGGACTTTAGCAA
AACTTCTGGCAACGGGTAAAGGGGATAAAGGCCTGAACCGCTTTGCCTCGTTTGGTTCCAATCTAGATACGATTATCACTGGCGGCGTGAAGCACGTGCT
GTTTTGGTCTGTCCAAGGAAAAACCATTGTCTCCAAGAAGGGCGTAGTTGGCAAGAAAGGGACTTTGCAAACGTTTCCAATGGGCTGCAACTTCGGAGGA
GACTTTGTAACAGGGACGGCAGGTGGTGAGTTGTATGTCTGGAGAGGCAATGATCTCTCAAAGACGGTGAAAGCACATGAAGGGGAAGTCCGAGCCGTGG
CCAGTACGAATTCAATTGATAACCCGGCTGGAAATTCATCAGTTCTGCTATCAGGCGGAAAAGATGGTCGAATTATCATGTGGAACCCTGCGTACCAGTC
GCTAAAGTGTTTTGATCTGGACGCAATGCACGCCGGGAGCTTTGGCAGGATCATCAATAGCGTGTTTTTAAGCTCTACTGGCACGAAACTTCTCGTCGGT
ACTTGCTCCAGTGACATCATCGAGATAGATGTAGTCAGTGGGAGTGTTCTCAATGGAGGCCAGCCGCTATTCTCCGGTCACTTTGCTATGGAGCTCTGGG
GGCTTGCCGTGCATCCCTCTCAGCGAGAATTTATCACCGTTGGTGACGACCGAACGCTGCGGGTGTGGGATATGGAGGCTAAGCGGTTAATTCAGGCACG
CGCACTACCTGCAAAAGCTCGTGCCTGTGCATACTCGCCTGATTCCGAGCTGCTAGCAGTTGGCTTTGGTGGCGACAATGGTGTACGCCAGAAGAGAGCA
GCAGCAGCCAAACAAGGGCAAACACAATCGAGAGAAGGAGGGTTTGCTGTGTTTCGATCACGTGACCTTGATACAGATAAAGTGGTGGTTGAAGACAAGC
CAGCTAAGGAATGGATCAGTGATATCAAGTTTTCGCCCTGTGGACGTATTTTGGCGCTGGGTTCTCATGACAACGCGCTTTATCTCTACTCTGTGGGCTC
CGGGGCAACAGAGTTCAAGAAACGCAAGCCATTCAGCAAGCACAACAGCTACATTACCACTTTGATTTTTCAGACGACAGCAGCTACATACAGTCGAATT
GCGGCGCATACGAATATTTGTTTTGCGATGCAGCATCGAGTAGCCAAGTGAGTCGAGCTTCATCTCTACGTGATGTGAAGTGGGCAACTTGGACATGCAC
CTTAGGCTGGCCTGTTCAAGGTATCTGGCCTGAATGTGCCGACGGCACTGACATCAACGCTGTTTGTGCGTCTTCATCGCGTACAATTCTCGCGTCGGGG
GATGACTCCGGCAACGTGAAGTTTTTCCGGTATCCTTGCATCCCAAAAGGGGTACGTTGCCTACTATTACGAAGACTTTGCGTGCACCTAACACCTTGTT
TTGTTATTGCATCTGCAGTCAAAGTTCATTGCCTGCCGCGGCCACTCTTCGCACGTCGCTAATGTGCGCTTCAGCTTTGACGACAAGTACGTGATCTCAG
TCGGCGGAAACGACAGATCCATTTTCCAGTGGAAGCTGGCCTAGCC