Description :
From Genome Similarity Track
Location :
scaffold_81:5342- 12357
Transcript NameFunction/comments
Plaha_PHALS_03233hypothetical protein
Plaha_PHALS_03234hypothetical protein
Plaha_PHALS_03235FOG: Transposon-encoded proteins with TYA%2C reverse transcriptase%2C integrase domains in various combinations

Sequence
7015 bases(100 bases per row)
CTTAGCGAGGTGCAAAGCACATGAATGTCAAGGAGGTAATTCATCACCGCTACCTTCTTTCTGGCAGCAGTCCCGCTAATCTTCAAAAGGCAGCTGTTAC
AGCTACTGGCTAAGCATCAAACTTGTAAGAAGGTCGGTTAGTACACACCGAAGGGGGAGGCGCTGCGACGGACGATCAAGTCTTTTTTCCAGGGAGATTT
TGCGTCGAATCATGAGTGGCCACGGCCTCAAGACATTTTGTCCGATGAAAGGCCAAAACGCTCATGGGCTTTTGAATGGAGGAACCCGTTTCACTTTACC
GCAATCTTAAATAAATCCTGGTACACCCAATCGGCCCACGTGGTAGTATGCCCCACCATGTAAATCGCCACTGCCCTTTCGACGGCTGGCTATCAAATGC
TCTCTGTTGCGGCGGCCAGTCTCATCGCGCCAAAAAGGTGTGCATTTGGCTGAAGCTGATATGGATTGCTCTTGTCCCCTGTTTGGGCTAAGCAATGACA
CTGCGTTTTTCAGCAGTTTAGAATTGTGTATCAAAGGTTTGCTTAGCTACAGACGATGATAAATACAATACTTTGCCTCCAACGGATTTCAGCACATTCT
ACTGGCATGTATTGTGATGTGGAATCAGCGCGTCCGCATTTAGGCATCGATCATGAATTTCTGTCAATGAAAGTGAACCTCAACCTTTCGTTTTGTAACG
ACAGTGTCCGGAGTGATGGAATAGGGTCGCGACTTTGTCTTACAGACCGTTGAACTTTGTATTTAGGTAAATTACCAGCCTTCAAGCGAACCTTTTACCG
GACTGCACCTTAAATCATCTTTTACCTGTCTGttgcttttgaaaattttcggATCTTCATTTTTCTCCTGCCTCTTACTTTTTCGtttggatctcagcta
aaGTATTGCACACAGCGCGAATAAAGCTCAATCTCATTGAAAACAGTGCTTGATTTGCTACGAAGTCTAGCCGGGTTGCTAATAGCAAGAATAACTTATT
TCACACACCAAGGCCGGAGCCACTTTATGGCGGTATCGAAGAATCTCTAGGGTCAATCTAGCAAGAAATAATCATCCAAAATCTTGCAGGGGTATACACT
GTGCTATTAAATGCAGACTTAATGCGTGAGGACAACTCGCTCCAGCTCCGCAGTCTCTCCGTGCATGTTTCCAAAAAAGATCTACACTCACGCGTGTAAC
GCATTCCATATAAACATCTGACTGCGAGTAATTAGCTGTTGTCATGCTGAACAAAGTCTGGAAACCATTGTTTTAAAGCGCAGATTTCTATTGGCCTGTC
AAGCCAAGTTGGCGAAACGTTTTGTCGCGAAACAGCTAAGCCACATTTTCTTCGTTTACATTATCGCTACCAGCGAGGACACGAACCATCTTTCTTAGAG
TGTTTACAAGTCGGGATACCGGACGAGGTTTTTGGAAGATTCAAAAATGTTGATCCCTTCGCTTTTTGAAACTGGCGTGCTGGAGAAAGGAGCCGTTCAT
GTGATAATAACATTACTTGCTGGCACGCCTTTCATGTGCACATAATGTGGTTCCTCACAGGCACTTATTTGCGCACATACACTGAAGCGCCGCTCGCAAG
TGTATGATACTTTTTTCGACATCCGGTTTTTAGTTTTCTTCACGAACACGGACGTATCAAACATCAGCATTGGTTTGTGCATGAATTGGCAAGAACAACA
GCGTCACCCGACGGCTGAACGCTCGTGCATAAGAAAGTTCCAGTAAAAAATCTcacagagcatcccgctcggagtactcattGCAATAGGAGAGATCATG
GTGTCGATGGTAATCATCGACTAAATCGAAGGACGTGGAGTCTTGTTGATCTGCAGCATATACTATAGCGGAGCCGGCATTTGCAATAGTATTTTGGCAA
ATATGGCTTTTATAAGGCATAAACAATTCGATATATGCCGATACATACAAAGTGACGCCGAAAATATATATACTTTTTTCTTGGTGAAATTGCTTCATAC
TGTGCGAGGAAGAAAGTGTCACTGGCGTCACAATGTTACCTTGGAAAATAGACATTGCTGTACGTCGCAATATTTGTTCCAAGAACTAAGTCAATTTTCA
ATGCACTTCCCTATGCAAGGATAGCTCGCTTTGCGTGTCTTTTGCCACCGCGTCGCAATATTTTTACAACAAAGAATAAAACTGTTCTGAATGATGCTTG
AATACTCCTGATACATTGTCCTCAATGACGGACTAAACCCTGAGGATGACGAGCTCAGACTTCCTTGTCCTAACTGTTCATACTCGATTGCCTTACCGTC
TTAATATTCAAGATctctcacagaggaagcGAAGGGATTACCACAATCGCACCGTTCACAGGTATATTTTTTCCCGCAGAACCAAAGAGCAAAAGCTCCG
TATAACACTCATCCACCAGGTGCTGCTTATCCAACTGTAATGTCACATTATTGCAAGATAAAATCAACCATCCACTAACCAGGTCTGGCCCTTATACTTG
TAACTTATAGTCGCCTTTCAACACCACCGAATCTTGCACGAGGGACTACGATATCCAGTTCCTTACTCTCCAATAGCTCTGACATAGGAGATATCACCGT
ATAGCTTTTATTTACCATTGCGCCCGAGATAACGTCTGGACCGTCGTTAATTCTCTTCTTATCAGCAATAGAAGATAGATACGTTGCTATTCAATTGTTC
CCTTGGCTAGACCTAGGACCACCGCTTAATGCGGCTTACGCCTTCCGACCGCTACCTCAAATACTCATCAATAATGAGTATTGCTTACTAGACAAGTCat
caattttattttaaCCCAAAACTATCATAGCTTCAAACCAGCATCAGAAGCCTTTCTACTCCGTTGAAAATTGTTCATCACTCACTGAAGCTTTATTAGA
TAACCATTAGAATTGAGAACACGCGCAATTAAAATTAAACGGTCGCCTCGTTTGAGGCTCGCGTATCTAAGGCACCGTTACGTCCCCAGGGCCTTCGTCA
CGCATTCtcggctcaatgagccctgtgtctatgacacgaaaagctCCCAGCTTTGCTGGTTCTGAGACCGCCCACGGGTAGAGcctttcttcgtctcctg
cacgcggtacaACTCCgggcagtacgtccgcggctctACGGGAAGCACGTcttaagccctcggcaactgggcACCGCACACCGAGTCCGACATAGGCGAC
ACatctcctcgtcgaggttCCGGGGgatgtcgactacgagtcggatcctcctttcccaggatgacaagaagaggagggcgaggtgtgcaaacggcgcgac
gtgggcCCTAGTCGaaacttgcggacaccgtgtctgtTTCCGACCTCTCTTTTTTTTAGGCAAGGGGTGTTTTAGCAATTGTATTGACAAGGcaaggagc
agcagttggaggctgcacACACATGCGCTCATTTCCACGTTCAGTCTCTGAGCCAAGTgaagaatacggcttccacaCGTCGACTTCCGCAACTAAAGCG
AAAGCCAcggtcactcgatcgttaggcgtctacaaaGTCGCTCcccggtcactacacaagctgaccaTGgacagcggaaagctctgcaaGCTCACTTTTT
GATACCACAACAGATCCCAATGGGGTGGAAGCGCGCTCGACCTCAAGCTCAAAAACGAGGTGCTCCTGCTCCCGCATTGCGTTTTTTCCGGTGGTGGTAG
CCCCTgctgaaaccgctgcagatgataataGGCTCTGTGAGCGATAAATGTAGTGAAACCAGAAACTTTCCTAGCTGTCTTACTTACATCGGAGCCAcat
ggaagtggacgtgcgcgttgaacgccatcttcgattcgaGTTTGTCAAATTTAAGGCACAACGCCGATTTCctacgtattgtcgccctgcgtcaTATAAA
GTACTCTATCAcgcccccgcgagctctgtaatTTCTTAGCTCATGACtcttcggcttcccgggctactgcggAGAAGCGCGTAACGTACGACGAGGCGAg
gtgtcatgatccttctgatcataagtacccacgacgtctgggcagtcttgccgaagtggcacctcaaaccccCACAatttctcggagtttgggtgtcccc
gccacttcacaagattttgGGTTCGACCCAAACGACGCCTACGACCAACAAGACGCTCCGCGTGATAGAGGACGttaccattctcgtcgagaagtgtCGG
TGGTAGATGATGACAacctggtcgatcgccgtccggtgactcgcgatggccttcgagctcttgaggacaaagtccgtcgtcatcgccatTCCGTTAAGct
tcttgccgaggtcgcataccgctatGCGGTAGACCACAAGatcctggagcactttgtgcactgacTGTCTCACGTTGAAAATTATCACGCTCTGACGGAG
CGGCTCCTtaccgtcgagcagacgaatgcgtcactttgtgcgaccTTGCGCCGTTAATaatggaaattgttgcatccATTCCCAGAACCAgattctgggt
ggccgagtgcTTTTGTgcgccgccccggcaccaacgctttcgcgttcacttgcaccggatccaGGTacagcaagcccacataaaacaccgggttggtgcg
catccttctcggaaggtgtAGCGTacacgcaaggcctcgcttagccacgaccttaggaggtccgataaaccacCTTGGACGGAACTTTGTCTAAAAGATG
GCAGAGGATGCATGGATAGAAAGGGTTTTAGCATttattaataaaaccagatctccgacctcaaagtttttaacATTTCGTCTACCTCTTCTGTCTgata
tttcttctgcatgtcttggctttcagccatagcatcgcgaacgtgtcgtaagacactcagtctagtaaacaggaagtcatcgactttttgaCAAACAGTG
AAGGGAGTTCTAGCCACTCGGTTATTCCTCCCCTACCAGGCCCTGAGCTataggatggcggcgtcagcgggacgcgaagaTGAACGAGTCCCTGTAcgag
tagccggtagacgaatgcactgcattgttcagagcgaactccAAGAAtgacagcatggcgctccagcatcTCTGAGTCTCAGCGAAGAACGTCGTCAtcg
acgcaattcacgcgctcagtttgaccatcggtctgcggatggtccgctgttgacatagtcaacttggtgcccaacaCCCTTAAGATCGCCAACCAAATCT
ACCAGTGAAGCGTGAGTCTATGAGAGCgacaatcgactccgggATGCCATGAtgccgaaagacacgatccacaaacgtcGTCTCTGTAACCACACCgttg
atggtgtccggcactgccgcaagatgagccattttgctcgaacggtcgacaaagaccaccacacccgtgttgtctgccgagtcctttggcagaccaaaca
caaagtcaataCTACAAAGCATGACTAAGCTGGAATCATCAAGTTAATTAGTATAAGGAATCCCTTCGCCGAGAGCGGAGCTACTCCGTGGGAATGTCAC
GGGGACGCAAGTAAAAACATACTATTTATAAAAGATGGTCGAAGTCTGTCAAGGCAGGAAAATGTCGTGTAGAGATGGACCCAGAATCATGAAGATCTTA
GTTGATAATAGTTTTATGATTGGCCAAATGGTAGTTATGCATCGGGTGAACATACCGACCTACAATTTGCTGAACCTGAAAATGAGATCTGTTCCGCCAA
TCAAACTCAGCTGACAAAGAACAACACGACCGactcaatcttgatgagtgGGAGCATATCGCTCTAGCATTTTAGACGCTTTACTTATGTGTTTTATGTG
ATATATCCCGCCACAGCATTAAATTGTTCTGGATATGAGTCTTGAATATTTTGTTGTGGACATATCTTAAATAGTGTCCGGTGCCTAAAACAAAGCCTGG
CAGAATATTGCTATCAGACGCAGATCTTGATACGAGTTGATCACCacaggtgcagcggggctgccgtagctttgcgcttagaggaagcgtaagttaggtc
accgaccNNNNNNNNNNATCGTTATCGCTTCTACATGAagttgtcttggaagacaccaagagagtgctgaacgcacggagtggatcgtcgatcctacgaa
atCTCCTGGATCCGTattattctttggtaaaggaatttcaagacctcgtcttcaaagacccgccttcggtcctaccaccggaccaaggtgtgcgtcatga
aggtcgacctggttccggaaatcAAATACttcgtaacacgccaatggcccctgcccaaggagcagtgcgacgtcattgacgcctttttacgtgcaaagca
cgacgcaggattggtacgtgagagcaagtctccctatttgacacccacgttttgtgttcggaagccgaacggcaagtggtgtatcgctCATGCttgcaat
aagctcaatactgccaccattccggcgcagacgccgattcctagaaaggatgttcttcagaacaacatggtgggatgtacgaagtactattgcactcgac
ttggtctatGGGTATAACCAATTgcttatgagagcgagtaatattccgctaacagcggtgagcactccgagcggtatgctctgggagtggctggtgatgt
cccggctgtcaaatgcaccagcaacatttaatcgtcttgtgacgcagttgttcaggccccaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNN