Description :
From Genome Similarity Track
Location :
Scaffold_608:5342- 8450
Sequence
3108 bases(100 bases per row)
TGAACTTAGGTGTAAAGTTCTAGACTTTAACAGCATTGAACTCCGTATTGTCTAGATTTGGACTCAAGATATGATCTCACTCTCGGTATAGTCTGGCTGG
AACGCCACGAGCCATAGATTGATTGGAGGTCCTAGACCTTAGGCGCAACGCGCAATGTTTCCAGTGAAGCTTTGGAGAGTCATGAACCCACCTTTGCTAG
ACAACAAAAAAGCTATTGGCGCGAACCACTGACTGAGCCAGGTAGTGTACTGGACATCGGAATGTCTGAGTAGGTTGACTCTGATGTCAATGACAATAGT
GAGACGGCACGTACTACGTTGAGTGGCACTTGTTATTACAATGCACCACTGGATGCTGATAGCATTGATGACCCTAGGTCGAGTCATTTAGGGTGTGATA
CCTTAGATATACGTGCAGTGGCACGTGAACATCCACAGAGTGAGGGTGGCTGCAATAGCACCTCACTGAATGTCGGTAATGACATTTTTGGCGAAGTGCC
CCGGCATCAAGAGCGAGGCTCCTCTGATGCATGTGTAGTGGCACGTGAACATCCACAGAGTGAGGGCAGCTGCCATGGCACCTCACTGAATACCGGTAAT
GGCTTTGTTGGCGAGACGACCAGATATCAAGATTCAGACTCCCCTGATATATGTGTAGTGGCGGATAATTCGCCGGGTAATGAGTTCGAGTTAAGTAAAT
CTGCACCGGATGTCGGTAATGACACCAGCTCTTGTATAGATCACGCTAAGGTTGATATAGCTAATCACCTTGTGGAAAACCAGATGTTCCGTCCTCACTG
AGGAGTTCAGTCTCTTTTCAGAGACGGCAGCGACGNNNNNNNNNNGCTGTGAGACGAAAAGCGTCTGTAATGTCACTTAGCGATTCTAGTGATCAGATAT
ACACTGGTCTATGGCGTGACAGGTTACGTGGATGGTAAAGTCATCCTTGCGGCCCTTCCATCGTTAACTGCTTTGTTAGAGCTAGACGAAATGTCTGTAG
ACGAGTTCAGCCAGGCCCTGAAGTCAGGCGACTTATCCGATATGGTGGTCCTTAGACCTGATAATGAGTTGAACTCCTCGTCTCTATTGGATGAGACGGT
CCTTGAAAGTACAAAGACGACACTTAGTACATGAAGTGAATCATCTATTTTGAAGAACCCTCCAGACCCTTACTACCCTTTGTTTAAGTAATTTAAAGAC
GTGGTATGTCATAATCCAACGTCTGTATTACCTCCCGATAGGGGCGTACGTCATGAAATTGAATTGGTTCCTGGAACCAAATACTGCGTTACACAGCAGT
TGCCTTTACCAAAGGAACAATGTGACGTCATTGACGAGTTATTCGGTGCTAAGCATGCGGCGGGAATGGTGCGGGAGAGTAAGCCTCCTCATTCCACACC
GACATATGTGTGAAAAAGCCTAATGGTAAGTAGGGTATTGTGCACGCTTATAATAAGCTTAATGCGGCCACTATACCTACACAAACACCCATTCCTAGAA
AGGACGTTCTTCATAACAACATGGCAGGATGTACAATGTACAGTGCAATCGACCTGGTCGATGATATTATCAACTGCTCATGCGAGCAAGTGATATATCG
CTTACAGCGGTTAGTACTCCAAGCGGTATGCTTTGGGAGTGGCTGGTTATGCCCCAGGGGTTTTCCAATGCCCCGGCTACGTTTAATCGTCTGGTGACGC
AATTGTTCCGCCCTCACTATGCACAAACATATTTCGATGACACATTCGTCCATAGTCGGGCGGAACAGGGTCGGTCGGACGTGTATAACCACATCAACCA
TTTACGAGCTGTGCTCGAGTGCATGCGCACTAATAAGCTCTATGCTGATGCATCGAAATGTATATTTGTTGCGGACGAGATCCCATTTTTGGGATGCTTC
ATTGGGAAGCGAGGCCCTCGGGCAGATCCTGCAAAGGTGAAGGCCATAGTGGATTGGCCAGTTTCTAAGAACCAAAAAGACCTACGCAAACGGCTTGGCC
TTGCCAATTACTTGCACAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCATTATCCAATCTCCTTAAAAAGGATGTGGAGTGGTGGTGACTAGCAGA
GGTTTTTAAGGCCGTAAAGGGGAGTCTTCTACATGCCCCGATTTTGGCTTTGCCAGATTCTGATCGGCCTTTCAGTGTTTCCTGTGACGCTTCGGACTTT
TTCATTGGCTGTACTCTGTTGCAAACAGATATTGAGGGACGTGAGCGTGTCATCGTTTTTGAATCCCGTCAGCTTAAAGCTGCTGAAAAGAACTATCCAG
TTCACGACAAGGAGCCACTTGATATGAAGTATGCTCTAGTCAAATTCAGAATTCATCTGCTTGGCTCTAAGCCTTTTATAGTCTATACCGATCATGCGTC
TTTACGCACGGCGACCCAATCGCCTCACCTTTCGCAGAGGATGGTCCGTTGGCTTTCATTATCTGCAGAATTTAACTTCGAGGTGACGTATAAGCCGGGA
AAGCAGAATACGCTGACTGATGCACTGTCACTACGGTCCTACTATGAGCTTGCTCATGTTACGATTTTGTCGTCGTCAATTACTAACTTTATCCGTTCAT
CTTATGCCAAGGATGAACAATGTGTAGCTTTGCTACGTGATCTTTTTTTGAAGCGATGAGGCTAAAGACTCGGGCATTAATTATCGGCACGTTCGCGTGC
GAGGCTACATCAATATTCTATCGATAACGGCTTGTTGTGCTATCGCACGGATGCCACGGATACACCGCGTACCATTGTTCATCATGATGAGGAACTGAAT
TATCGTATCTTCTATGAGGTCCACGAATCAGCTATCAGCGGTCATCTAGGTCGTGAAAAGACCTACGGCTTGGTTAGCCAGAGTTATTGGTGGCCCAAAA
TCTATAAAGGGGTAAGCACTTATGTTCGCACATGTGAGACGTGCCAACGGGTCAAACCTTTGGCACATGGGACTGCGCGGCTGGCTATTTTTCTGTACCC
TCTGGGTGTTGGGGAGTCCATCAGCATCAACTTCGTGTTTGGACCTTCCGAGGGATTCGGATGGCAACACAGGTATTGTGTCTTTGGCCTACCGTTTGAG
CAAAATGG