Description :
From Genome Similarity Track
Location :
Scaffold_1126:5341- 6834
Transcript NameFunction/comments
Phyta_totarag12137hypothetical protein

Sequence
1493 bases(100 bases per row)
CACCCAGGAGTTTCCAATGGCGCTACTGGTAGAAGTTCGCCATATTTTGCTGGCCGTGAGAGACGCTTTCTACTCAGGACTCGATGGTGGTGGGTGTATG
TACCTTCACGGCGATTTTCCCGATGCAGATGTACACTACTGCTCCAAGTTACTTGGTCCAGGAATTCATGCACATGCTGGAAGATATGATCTTTGGGTCA
CCGGAAGCAGTGATTTCAAAAAACTGCAAAAGACGAACAACTCTGAAGATAGGACGCAGGACCGAAAGACCGATTTGTAGCTCCGATCTTCGCTGCCTCG
AAAACCTTCAACCACTACAACCTGAAGCCGATTGATGTGGGCACGCGTGCAAGACCTATCAGGCAGAGGCTCGTGTGGGAATTATCTTGCTGGCTTCGGC
TTGATTTTGTGATTGACAGCTTGATAAAAGCAGTCTTCCATTGCATGGCAAAGGCGCCACGATGTCTCGATTTTGGCAGAGTTTCGACAACGAGAAACTG
GAAAGTCCTGCTAGTCGCACGTCCAATCCGCATGTTGAAGTCTTCGTTGACGCCCAACGCATCAAGGGCGCACCGGCTCAAGCGAATGTCCATCAAATCC
TGGGAGTGATCGCGGCTGATTGTGCATTGCTGCAAGGGTGCATTTTGCAAGTCCAGCTTCGTGCAATAACTCGTTATTGCAATTAGATTGAGGTTGACAG
TATCACGTTATCggatacttcgaagtactcaTCTTTATTAATAACTACAGATCCCGTTCCGAATCAACGGTATTATCCGGTGTTGCGTTTAAACCACGAT
TGGATGAATCGTGGAGCTTTTCAACCAGCGCCGtcacttcttcttgagctcatTCTCCTTTTTGatctacttcgaagtaccacGCAACCTTGTCAGTAAC
AATGTCGCTACAGTCGTTCATCAATTGTAATGCTCATTGAAGCAGATAAGCACGAGATGGCCCGGAAATCGGCGATGCGGTCATACATAACGATCATTTT
GTGCTTGTCCCTTCTTCGAGATAAATGCGTGCGTGTGCCTTCTCTGGCCATGACACTTTTCCCAAAACCTTTCCCAACATCCCTTTGTTTAGAAGAGTCC
ACCGACGTTGTTCTTGGATGAACCGGAACCGGGTCACTAGTTTTTTTGCAAACAAAAGAGCCACCACCCCAAACGGTTGAACTACATGAGGATCTACCTA
GTGAAACAGCTTCATTGTTGATTTTGCACCTTCGGGTTCACACACGGCatcccagcagcagtcgtcgagctcaGTCTTACAATACTTGGATGGTTCAGTT
AAGGGTGGCTTTTGTCCTCTTGACTTGGATCTACGCTATCTCTGAAACAACGTCATTCGACCTATCcttcgacgatgacgactcATCCGAAGCTTCATCA
CTAGACGCAGCACCAGGGACTGTGTCTCCTGCTGTCCAGCTGACTACGTCGGGATTTTCGTCGCTGCATGACGCCAACGCTACGCAAacaact