Description :
From Genome Similarity Track
Location :
Scaffold_20:534090- 536327
Sequence
2237 bases(100 bases per row)
CCCCTCGAAGGTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGG
ACATGCTTCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGTCACGCCCTCCGGGC
CAAGCAAGGACATAAGCTTAGTAAGCGCGTCCTGCTTCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACT
CAGGAGCGGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAG
TTCCTTATCCAAAGGAACTTACAGCCCAAGACCAGGGCTCAAAGTTAATACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGC
GGCCAAGCCGCCTAGGGGTAAATGTATCTGTTTAACTATCTAGCATAGTTAAACCTAATCAATTGCATAACGTGTGGCTTTCGGCCAACGTACTGAGAGA
CCTTGTTAACTCTCCAACTTATGTACTGAGAGCTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACACTCTCCC
CCACTAAGATGAGAACATTCCGTTCTCGAAACTTTCCTCAGCGAGGTCACGTCTTGCTAAGACGGCGGAGGTTACTACACCTCACCCCAGCGTTGTACAG
CTCCGTGAGCTCACAAACGCCTACGCATCGTTGATGCCCAACTTCTCGTCGTCGGCCCACGGCCCAATGTTTCAAGCGCAGCGCGCATCTTGCTCTCAAG
CGGTCTCAGACCTACGCTCGCGCTCCGCGCCTACTCCAAGAGTTGCAACGGCTTAGAGCAATGCTCTTGACTCGTTCGAGTCGTCGACAACAGCTCAGCG
GTTGAACACTCGCTTCACAAGCGATAGGTCGGTGGTTCGAACCCACCAGGGCACAGCCCTGTCGTTCCATGGCCGATTGTTCACGCTTGGACAAGCTTAA
GAGCAATCCGCTTTTAGCTCAGTGGTCGAGCGTTGGCTTTGGAAGCCACAGGTCGGTGGTTCGAACCCACCAGGGCACAGCCCTCTCGTTCCATGAACTG
TTGTCCTTGAATGGACAAGCTTAAGGGCAACGCCCTTTCAGCTGAGTGGTCGAGCGCTGGCTTTGGAAGCCACAGGGTCGGTGGTTCAAATCCACCCGGG
CGCAGCCCTCTCATACCATGAGTAGTCCGTTCTCGGACTGACGTACGGGCATCGCTCTTATAGCGCAATGGTAGAGCTCCGGCCTGTCAAGCCAAAGGAC
AGTGGTTCGATCCCCGTCCGGGACACCACTTTCGCTGTTACAGCGCATCCACATTTGGATCATGCTCATCGAGCAAGTTGCTTCAAAACAACTATGCGTC
TATCGAGACGCTTGTGCCTGAACCTTGTTCAGCACAACACGAAGCGCCTGCTTCCTTCGGGACCATGTCCCTAACACTACGAGGTCTCTCCACCTCCTGC
TCCCGCTGCAAGCACCGCTCATACGTACGAGCTGGCTGCTGCAGCCACTGGTCAGAGCCTGAGCTCAACTACTGACCTCATCGCTCCCCAGGCGCCCAGC
GCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCGCATGATGTGCCCGGTCGTAACGTCAACGACGTCAGGGCAATCTTGCCGGAGGATAACCTC
AAACTCCCATGAGTTCTGTGAGTAAGGGTAACCCCTCCACTTCACTAAGTACTGGGTACGACCCTGGCGTCTACGCCACGCCACAAGGCGTTCGACGTGA
AAGTGGAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGCTCTCGCGGGGAGAGTCAGCACTTGCCGGAGCGGCGTCTGCGT
CCATACGACGCCGGCGTCCACGACGCAAACGTTCACGTTCACCGCCCATCGGTCGATCTCGAAGAGATGATCCACCTTGTGGATAGGTTAGAGCCACCAC
TGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGTCGCTCGGCTGAACGTTCAGCTTGCCTTGCTCCTGCATCTCGAGCACTTCGCTCCGCGACC
TGTGGCTCTGCCACATGCTGTTGATCAGCCATCTGTG