Description :
From Genome Similarity Track
Location :
Scaffold_2305:534- 2996
Transcript NameFunction/comments
Phyag_g12319calcineurin-like phosphoesterase, putative
Phyag_g12320peptidyl-tRNA hydrolase, putative

Sequence
2462 bases(100 bases per row)
CACTTGAACATCTCCGACTCCTTCTCCGCTGCTGGAAACGCTCGTATCCCTACCCGCTACTTCGCCGATGCCCCCATCGCGCTGCTCGAATCTGCGTTAA
AGTACGCCAAGGAGCACGTAGTGAGCGACCCCGAAATCTTCCTGTACACGGGAGACCACGCGGCCCACGGGTTATTCACGGATGAATACATTGCAAAGGC
AGTCGAGACTAATGTCCACGCGATGGAGAATTATTATCCACCAAAGAGTCAGGGAGATGGGAAGCTGGAGGCGACTGCCATCATTGGCAATGCAGATGGG
AGTAAGTATTTATTATTATTCTATGAGAGAAGATGGTGGTTGATGTCTTGTATTGACGACAGACCCGGACTACCACATGGACGTGACGGacccggagacg
gagacgaacCCGACCATTGAACTCATCTCGGGGGTTTGGGAGAACTCGCTGTCGACTATGGACATGGATCTGCTGAATCGACAAGGATATTTGATCTATG
CACTGGACGACAAGCTGCAAGTCATCACCTTGAATACTGTGGCCTACTCGGTGAGTTAGTTGTGTATCAAACTAAATGAAACCAGGGTGGTGCTGACAAA
TAATTTTTATTTTGCTGATGTGCAGCCAAGCCATGTGCCAGATACGTCGGATCAGCCGGACCCGTTTGGTCAATTTGCGTGGTTGGACAAGACGCTTGCT
GAGCTGCAAGATGCTGGCAAGTTCGCCTACATTGCTGGTCATATTGCTCCTATTGTGGACTCGTACGGAGGAAACCCGCAGTGGCACACGAAGTACATTG
CCAAGTACAAGAACATCGTCGGCAAGTATGCAGATGTTATCAAGGCACAGTTTTTCGGACATGTGCACAGTGTCGAGTTCCGCGTGCCAGTGGCGTCGCT
GGATGGAGCTACAGGAGATGATGACGCGTTCCAGCTGCTACCGATGTACATAACGGGCTCGATCTCGCCGCTGTTTGGCAACAACCCTTCTTTCATGGTT
TGGGACTACGATGTCGAGACGTACGAAGTGTTGGACTACACCGTGTATGCGTCTTATATCGCAGAGAGCGAGCCTCAGCTCGACTGGAAACTCCTTTTTA
AGGCGAGCGAAGCGTACGGTCTTGAATCGCTATCTCTGACCGAATTGTTAGCCTTTGTGCACCGTGCAGAGCAGAACGCGAGTTTGGTGGAGGATTACTA
CTTGAACATGAAGGCCCGTTCACCCAACGCCCGACCCTGTAAGGACACACCCTGCTATGCCAAGACGTTGTGCACGCTCAAGTGGTGGACTACGAAAGGC
GAGTTCCTCGCCTGCGTCGACACTGCCCAATCTATATTCGCTGATCGTATAGATGGCAACGACGTCACTTCAGTGGCTTCTTCTGACgtgacagcagcgg
cttcatCAAGTCCCAGTTCCGCCTCACCGGCCGATTTTGCAACCAAGGGCGTGCTGATGACGATTGGAGCGACGTCGCTAGCCACGGTCGTTGCCGTGGT
GTGTGTTGCACTTACCGTTTTCGTACTCCGACGTGCCGGGATCCTCAAAAACCGCGCGCAGTACGATACCGTGGCCACGCTCTAGAAGCAAATAGCACTA
CCTGCCATCAAAGCAGGGAAGGCAATCAAAATGAGCACTGACCTGGTCCCAGTTGAGCCGCGAAAGTATCTCTTGTTTCCCTGATTAACCCAAACTCCCA
CACTCACGCTCTACATAAGCTTGAGGTGGCCTGTGATCTCGTCAATAGCCTTCAGCGGCGCCGGGCCAATTCCCAACACTGTCTTACTATCCGGCGCAAT
CTGCGTCCGACCGGCGTCAACCTGCCAGCATCAAAAGCCACCCAACCGTCAGCAACTCAAGTCAACTCCTCTTCATGTATCACCAAGTCACTCAACGAAC
GTACCACGACGTAGTTGACGAGTCCGtgctccgccgccttctcggCCAGAGCaagcatctcctcctccgagtccACCTTGAGACAGACCTTGGCTTGTCC
CAACATCTCCCACGCACGAACCGCGTCGGGCGTCCGCTTCAGCGCGCGCTTGTAGGCGCCCAACGTCGCGTGGCAGCACTGGGCCGCGATTTTGCCTGAT
TAACAGTGTGAACATGAGATAAAACACCCAAACCAGAGCCTAAAATCAAGCGCCTACCTTTGCCCATTTTCAGGTCCGTGCGCACGCACAGCACCATCTT
GTGGGGCACCCAACTGACGGAATCTTCGCCCTCCCAGTCGTCCGAAGAGCCTGAAGAAGATCTGGACGAAGCCTCGGAGCGAGAGTCAGCGGGGctgtcc
ttgtccttgtcgtcgccattgctgctgctagtggCGGAGGATGCAGTGGCGCCCAGCAACTGCAAGGAGACGAAATAGTGCGTTGCGGCGCCCAGCAGGA
ACGCCGCCGTGCACTTCCACGCGACGTCCTCCATTTTTGCTCTAAGGTGTGAATGGTGGCCG