Description :
From Genome Similarity Track
Location :
Scaffold_563:534- 2679
Sequence
2145 bases(100 bases per row)
TTTCTTGGACCGATATCAGATGCCAAGATCACTTGAATGACATTACAAATTCAAAAGCTGCTAGAGAAATTCGAGCTTCACGCAAATGGAAGCGATGATC
GATCATCTTGTTCGTTTTTATAGCACGCGTCTCAACCAAAAGCATCATACCACTGCTAAAGCCAGGCGAGGTGAATGACCTGCCACTACCAGCCCACACC
ACGTTCGACTAGATCGATAGCTTATCGAACTTTCCTTTGCAGCTGTAGAAGTGTGATGCTTGCAGTAATGTCAACGCATCGTCCGTTACCCATACCCATA
CCGCGTGGTGGCCCAGAATGGTGGAAAAATTCATCGCATACTCGATACAGGGACAGTTGGCGAAGAAACCACGCACATGGGTTTGAGGCTGCAGCGTTTC
CCCACATGTGGGGTTTCACCAAACTATATAACTGCAGCATTTTCCACACGTGTCGTTTCACCAAACTGGTTATGACCTGATACGCGACAAGTCAACCATC
AGTAGATGCGACGCGCTATGCACATCGCACGATAAAAGTACTTCGTGCTCTCTAGCTGCGACTATGCTAGACACGCGCATTCCGCGGCGTCGTATGTCGT
TGCAGCCAACCTCGTTTTACAGAACGAATTATGCATTTATTAGTTATCACAAGAATTATGCGGGGAATACTTTATTGTCAGCAGATAGAAATTAAATTTC
TCGTGATGTATTTTTATTTCTCACACATAAACTTTGGCAATCCGATAGAAATAAATACAGTGTGTGGATCGTTCGGTTTAAGACTCGCTCCGGATTCTGA
TACGGAATCAGCGCCACTCGTATAGAGTCCCACACTTGACTATTCCATACGCCGGCTGGACAAATAAGCAAGCTAGCTGCTGATGACGCCCGGCTGGACA
AAATAAGCAAAGCTAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN