Description :
From Genome Similarity Track
Location :
Scaffold_809:534- 1886
Transcript NameFunction/comments
g6782.t1POM66197.1 Putative retroelement, partial [Phytophthora palmivora var. palmivora

Sequence
1352 bases(100 bases per row)
CATCGCTGTGAACCACCTCCAGCACGTGCTTCGCACGGTTCGGGGACGACTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACCCCCGTCGCACAG
CTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGC
CAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGCCTCAAAAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGC
CCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAACACCCGTCGCTCTCGAAGGTCACTGGCCCCACGTCCTTGGTGAAGCGGCCGAC
CGAAAACAGGTTGCGCGACAACTTCGGGATATGCCACACATTCGTGAGTACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCG
GTCCCCACTGCCTGAACCACCCCGTCGTCCGCGAGATGCACGTCCACCGGAGCCATCGTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCT
GCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGCACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGAATCTTCTTCGTCCTG
CGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGACCCGCGAGGAACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCAC
GCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTATTGTTGACCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTT
GTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTACAACGCCGTGATCAGGAACTGGTA
CGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTG
ATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTGGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTACTT
CCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAAATGATCGCCAGCGCCTTACGCGA
CTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTC