Description :
From Genome Similarity Track
Location :
Scaffold_4003:534- 1569
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4003-fgenesh-gene-0.0Heat shock protein 70kD

Sequence
1035 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCCCGAAATAACGGATGCACAAGGCAACCCCTCCCAAAAGCATTTTTCCTGCGA
GAAGAAGAACCTGCGAGCCATTCGCCATTCGACCTGCCGCTGAGCAGCTCACCGCCATCAGCAGCCTCAGCTCCACAGCCAGCTGTCGCTGCTCACCCGC
CGATAAGAACCCGCCGCGTCGCTGCTGTTTCTAGGCCGCAAGAACGAGGAGCTCATTTCCACAAGTGATCACAAAACAAGAGAGACGAGATGGCGCCGTT
TAAGCGCTTCCAGCTGCGCTCGCGCGCCAACTTCATCAAGTACATCGGGATCGAGCTGCAGCTGCTCAAGAAGGAGTGGAAGATCCTGCTGCCCTGCGTC
CTCATGCAGTGTACGTGCGTTGTTGCTGTACGCCCGTCGCCTTGTATGTGATGTTAATGCGCATGCTGGGTATCTCTGTATGCTGACAGACGTCCACGGC
ATCTTCCACAACCTGGCGTACTGGGTGCAGGGCGCCAAGCTCTCGGAGATCCAACGCTTCCCGCTCTACGACCTGGGCTTTGAGCTCATGTCGGAGCTGA
GCGAGTCGAGCGCGCACGCGTCCGAGTACCTCGTGTTCGGCGCGGTCTTCGCACCGGCGATCGCGCTCGTGCTCACGATCCCACTCTTCCGCCAGAATCC
GCAGCGCCCACGCTACATGGTGATCATCCTCAAGCGCGTGCTCTTCCACATCAGCGTCGCGCTCATCTTCCGCATCTGCTCGTTCATGCTCACGACGCTG
CCGGGCCCGGCGCGCCACTGCCGCTTGGTCGTCGACGCCGCGTGCAAGGCCGCCAACCCGAACGACATTTTCAAGTGCGTGTCCGAGAACCCGGACTTCA
TCCCGCCCCACGGCAGCAAGCTCTTCACGAACCTCGACGCGCTCAACGGCTGCGGCGACCTCATGTTCAGCTCGCACACGATCTACACGCTGTCGCTCAT
CCTGACGATCGTCAAGTACTGGACGAACAAGTACC