Description :
From Genome Similarity Track
Location :
Scaffold_6:53391- 55544
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.42Conserved gene of unknown function

Sequence
2153 bases(100 bases per row)
GCgCTCCGTGTGCTATTGAACGTCAACACATCATCACTGGTTGTGCAAGCACTAGCCGCACCACCCGGGGAAGGATTGCAGTAGCTGCTTTGCGTATATA
AAATGAAGTGCAGAAGAAAAAGAGGTGGCGTTACCCCAGCAGTAGAAGAAGTAGAACAaGTAAACCGTCCGATTTATCATCCCTGTGATACCATATGAGG
GGAGAAAATTACACCTCGATCCAAGAAATAGAAAAATCCATAGACTCACACTCCACCAAGACCGCAGATTGCGGTTCCGCCTCATCCAAGGTTCAAGTCA
GGGATCACGCCATACACGGAGCTTTGGAGATGATCAAGTTCATGATGAATCGTGGTCGTGGGAATTTATTTTTTtCTGATATCcGCCTTCTTTtCGCCGT
CAAaTGaGGAACTGCCcTCCCATCCTGTCAGCTTCAAGTTGGTGAGTCTCAGACGTGCAGACGGCgCGGGTGCTGGTGATGGCAGCTGCGGCCAGTCGCC
ACGGCATCACCTCAGATCTtCAAGCGAAGTGAACCcATGACCGACGCAGGAGACGAGGAGCTCTGACACAATGCCATCAAGACACTCGGGCGGGGTCGAC
TGGGTTACGCTGTAACCCcGAACcTAAGTTAAGTTCGGATTGTTCGAAAAAaGAGATACGTGGTGCTGGGAATGGCGTCGGCATGGCCGACTGGCGCCGT
CAGGAGCTGGATGGAGCTGCCGGGAgCTGGACCATCGACACCGCGCATCCTGGAGGAGGTCAAGACCTCACTGGACTCGGGGTACGCGGTGCTGAGCGAG
GTCAGCGCCAAGAATGCGGAGCTACGGGCGAAGCTACGCTCCAGCCAGCCACTGCTGTGGCTCGACGACGCGCTGGTGCTGCAGCGGCAGAAGCGCGTGA
GGGACAAGGCGAAGCGAGACGAAGGCAATGGAGACCACGTGGACAGGGCGATGCTCGAGTCAGAGCTACGCCATCGACGGCGTGTACAGTGGGAGGTGGC
GAAGCGCATCGCTCGAGTGGAGAGAGAGATCAGCAAGCGACCACCAGCAGAGCGCTCATGGCATGTGCGTGAGAAGAAAAGACGCGAAGAAGAGGCCACG
CGACGGCGGAAGGAGGAGGAAGAAGAGCGCCAGCGCCGACGAAAGGAAGAGCGAGAGCAGCAGAAGCAGCAACAGCAGAGCCTGAAGCAGCGCACGAGGC
ATCGAGAACAGCAGCAGTtGGACGCGAGGAGTAAAATGAAAGCGAAAGCTCTGGCAGATGAAGTGAAGCCAAGTGCGAGTGTTAGTGGGCATTGTGCGAG
TCAGGCTGATGGCGATGTGGATGCCGAGTTGGACGGGCCTTCGAAGTCGACTGTCAAGACACGACGAGGCGCCGAAGACGAAGAGGATCAGGAGGCGATA
GTGCCAGGGCCTTCTACACCAGAGAAGCTAGCAGCAGTATCAGATCACGAAGACGCACCCCACAAGCCAGACCCTTTGGATCGCATCGCGCGTGAATCAC
TGACGGAAGACCTTGTGAATGAGACGACGCGACCACAATCGCCTCCTGTTTCGGATCCAGCAAGTGGCGATGACGATGAACCACGGCCTTACCTGAACTC
AGGTCCGGTACAGCAGCAAGTACCCAAGTGCGAGTCATCACTAGGTCGTCAAGTACTCTCTGAGTACCGCACGATGCCCTCCAGTGTATCATTTGGCGCT
CCACCAATCACACAGGTTGGGAGGAAACTCAACAGTGACGTGCTGCGgCGGCTTTTCCATGACCTGGACACCGACCGTGATGGTcACTTGAACCGCATTG
AGACGTGCATGGCGCTGCATCGCCTACAAATCCACGTGCCAGCACcAcGCATCGCCGCCTtCTtCAaGCGTCTTTATACTGACGACGTCACGCTGAGTGA
aGCAaaTCACAAGAAGACAGCAACAGCGAGTCTGCATCGTGAGACCATGCGAGAAGTCATCAATTACAAGCAGTTCGTAGCTTTCGTGACGACAGCATTC
GATCGCCAGAGCGAACTGCTTCGAATCCAGACACACACCTCACGACTACCAAAAGcACCCCCcGTGACGATTCCACCGAGACCTACTCTTCCTCTTTCCT
CTCATCTACAAGGAGCAGGATCGCTACCTGGGCCGTCCGTATCCCCGACAAAC