Description :
From Genome Similarity Track
Location :
Scaffold_1621:5339- 6822
Transcript NameFunction/comments
Phyta_totarag13367hypothetical protein

Sequence
1483 bases(100 bases per row)
AAGTCCAGCCTCTCTACGTGCCAGAATTGATGTAGTATTAGTTTCTCTTTTGCTTAACCTGCAGCCACTAGGAGCTCAACGCTGAACTAGCTTCGTGTAT
CGTGTATCATTTGGTCTTATGGGCTGGCCTTGCCAAGCCCAAGGCCGCCTTGTTCTTGGGATCCACGCTGGACAGGAACTAGTCCAGCGGTTCGTGGATA
TTGACGTGATTCGGCACCGTCTTCATGCGCTTAACCAAGCCGAGAACTTGGGAAACTTGGAAAAGTCGTAGGTGCCCATGAGCTCGACATGTACGAACTC
TCTCTGCACCTCAACGAGCTCatcctggtgctgcaggacggAGCCTTCTCGCTGTTCGAGGGCAACACGATCATGCCGTGTCTGGCCGAGTAGTTTAGCT
GGACAGGTCTGTTCCTGGGTCGCGTGCAGGTCCACTCCAAGGTGAACCAGTCTCCTGAGCTGGCACCACACGAGCGCCTGCCTCATCACATCAAAACTTC
TGGTGCCGCGGGTGCGAATCAAGCAGAACATCACCACGAACGAGTAGGTCTTCCTCATTAAGGATACCCCAATCCTCATCACCAAGTTGGTGGAGCTCAT
GAAGAGGAAGGACGTTTTGTAGCCGAGATGGACCGCCTCGCAGGTAGCGCCGCTTACTGAACACGGGCGACTTGAAGTTGGCGCTGCCGAAGCCCCCGGC
CACAAACTCGTGGTCACGCAGGACTCACTCGGTCGCGTAGCTGGGCTGGCAGGTGACCATCTTTGAAAGGCTTGGACTTGGAGGCGAATTGAGCAATCAG
TCTGGATGTCGGGATCGTAAAGTATTGTAACAGGTTGGCGGCGCCAGCAATCGCCAGCCTGCATGCTGGTGACGGACTACGAGAacgtggacatgctgga
TGTGCCCAAGGACGTGCAGGGGGTGACGAAGCACTACGATGGTGTGCCAATAgcggagaaggacgacagTGAGGACCATTGTACGACGTGCAACAGTGCG
CAGCTGACGTCGAGCAGCGGCGTGAGGTTGATGGGTGCGCGGTACCCTTGAACGGCCGCCACACCCAGACGCAAGCGCGGCAGCAGAGCCGCACAAGTAG
GATCTTGGCGCCGAGGAGGCGCTGTGGACTGGATGATGAGTGCAAGGGCCGGCTGTGAGTGCGCACGAGCGGCTCACCGACCACGGGCAGAAGTGATTGG
GCACGTTGACGTACGGTGGGGCGGTAGGCTTTGCAGCACGACTGGCTGGCGAGTGAGACGCCTAAGTGTAAAGGCAGACAGTTTGGAATTGACTGGCTAG
CGAGTAGGCGGCACCGAGCAATAGAGTGAGTCAGCTGTAAGGCAGGCCGCAAGCGGAGCGGTTCGAGTGTCGGCGGGTGGCGTAGAGACGAACGAAGAGC
GACTGGACGAGGTCTGCGAGTTCGCGGAGGGTGTTGCGGTGAGATCGGGGACATTGCGGTTCCCGAGTCCACTGTGTGGTCGC