Description :
From Genome Similarity Track
Location :
Scaffold_38:533896- 537895
Transcript NameFunction/comments
Physo_135506hypothetical protein

Sequence
3999 bases(100 bases per row)
TCGAACTACTGAATTCATGTTTGTTTCAACAACATCACTAACCTTGCGTAAAGTTCAGCTGAGAGTGGCAGTGTGACTATGCTTATGATAACTGACTGAC
CTTCTTCATCTTCTTCACCCGTGGGGCTGGTTTTGCCTGCCTTCAGTCTGTAGTAGAGGTGGTGGTGTTGGCCATTTCACTCATCCCACAAATGTATTCA
ACGTGATCAGTCCCTCCGTTCTTTATCACGTTGAACGATGAGATCGCGTTGGCTATCCCGTCCAGTTGAAAGTTTGTCGGGAAGTTAGGATCGGCGTCGT
CCTGGATGCCGACTTTCCAGTACTTCATTTTGGGGGCCTTGCAGTCATGGGTGCTGTAGAACAGGATGTTGGTGTTGCCGGTGTCCGGAAGCCTGCTCCA
CTTGGCGGACATTGCGTGCTCGTCGAGGGCTTCGCAGTTGGTGAAGGTGTAGCAGGTGTCGAACGCTACATCCGTGACTCTCGTGAGTCTGTGCTTGAAG
TTTACATCGCTGTAGAAATCCACGTGGCCGGCGTGGGTCGTCTCCGCCAGTGTAAGACCGAGAAGCAGGAGAACAATCGTCGAGTAGCCAATCGTCATTG
ACGCGGTTGCGGTTGCGTCGGAGGTGGCGAAAAGGTGAGTGAAATGGTCGGTCGTCGGTCGGTACAATGAAATGTGTTGAATCCGTATCCACCCACGTGC
CCGCATGCAGCATCAGTGGTTTTATCAGTTCTAGAGCAGTCGTATAATCTGCGGTACTTGAAGCACAATGAGTTGTATTATCATGCAAGGGAAATCTCTA
TTAGTAGTCCTGCCCGTCTAGTTTTTGTTGGGGCGAACACTACTCAATTGATGCGGCTCGAGTGTCGACCGTGGCAGGTTCGGGGCATGTCGACTCCACA
CTTGCAACATTCCACGCATTGATCACCAGAAAAGAAGAAATGTTGAAGGGGAACAAGGTGGGGAAGCCCAGATCTCCGTCACTCTGCGAATCGATTGGCC
ACCATTGTACTCGGAAGAGCAATTTCGGTCGCTGTAGAACGCAATCATAGCTGCTCCGCCCTCGAACGCGATTCCGGTCTCTGGCAGACCCTCCCACTTG
GCAGACATCGCAGCCGAGGACGAGTCAGCGCAAACGAGATCGTAGCAGACGTCCGTTTGCACATCATTGACGCTCGCGAGCTTGAGCTCGAACGCTGAGT
CTTGGAAGAGCTCGACGTAGCCCGCTTGAACGCACAACGCCAACGAAATGCCGACAGAGGCTCCGAAGGTAGCTTTTTGCCGGAGAGCTCTTGATGGACG
TGTCGTCATGAGTAGTTCTAGTTCGATGGCGGAAGGACAAGTGAGAGCAGCATTGAAGCGCGCTATCTTTGATCTGTGACAGTTGGCACGGGATGAAATT
CTCCTCCTGTGACAAAGCATGGGATGAAGGTGAATCTCACGAATCTCCAGTACGTATCTTTTCGTACTAAAACGTTGGGAACGAGGCGAGGTTTCGTTGC
TAGCCTCCACGCTCGTTAGTTGACGATAACCGCTTAACGGGGCTGTCCTACGGATGGAGAAGCTTTACTACACTCACTACAGCTGGGATCGTGTGGGTTC
TGTCGGGGAATGTATTCTTAGTTGCTCTGAAACGACCGAGTGGACACGATCAAAAAGATCAATCGGCGTTTCCTGCATTGCAGTTCCTTGACGCACAACC
GGTCAATCCTGCAATGATCAACTTTGTACCTGGTAATGTTTAAAATCTACTCAGTTTTCCCAACTCATAGTACATAGAAGTCCGCGTCGTCATAATTTAA
ACGAAGAAAATAAATTGGATTTCTGGCAAGGAGCAGTACTTTTGCACGAAACAGTAAAAGCTGAGGGGGTCTTTGCCAGCCGGAGCCTCACAAACGCTAA
GCCAAAGCAGCGATTGTGCCATTGTCAAAAGCGCCACTTCCGCTTCCAGATGCGCTGTTGTTGATAGTCGCAGCAACGATTTCACCGGACTCGGTCGCAC
AGATATCCCGCCTGCCGTTCCCAACCTTCTTCGTACTTTTGTGCCAGACCATGAAGGACGAAACCTCGTCGTTGATCCCATCCAGCCGGAAGTTCGAGGG
GAAATAGAGGTCGTCGTCGCTCTGCGTCTTGGTCCGCCACCAGACGTTGCGCTCCAGGCAGTCTCGGTCCGTGTAGAACGCGATCATTGCGTCGCCGCCG
TCGACCATCTTCTCAGTCAGTCCGCCCCACTTGGCAGACGTAACGGTGTTGTCCAGCTTGTTGCACGCGAAGCTGTAGCACTGGTCGTACCAGATGTCCT
CGATCCTCGAAAGCTTGTGCTTGTGGTCGGCATCCCTGTAGAGCTCCACCCAGCTCGTTTCAGCGGTTGCAACGAACAGGATGCTGGCGAGGATGCAGCT
CTGGAGTTGCAAGTCTTTCATTAGAGCTGTGTTGCTGGTCGAGTCGCTGTCTATGAGGAAGATTGAGAAGTGCGAGATGGTCTTTGGCTCGGATGAAAAC
AAGTATCAGTAGTGAATTCATTTGAATGGATATGCAAATACTTTACTACTGGATTGCTTCAGGATTTGGGGGTTCCATAAAGCCATGCAAAAAATTGGTG
TGTGGATAGAAAAAAAGGTAGATTCATATACTTCGAAGTAAATCAGTCTCAGATAATTAGAACCGTTTGTAGGCCTTTGAAACCCGTTTTGGCTGCAAGC
AATAGAGGTATGTACGATGGTGCGACAAATGACCGCTGCAAAACATGTTGAATATGTTGATCAAGAGAAGGAAGTGGATGAAAGTGCATTCGTGCAACCA
AAAGATGTTTTCAAAGATTTAGTACCATCACTCCCACCTGAAGCTATCCCCGCATCCAATGCTTCCTTTCGAGTTGTAGTGTTCGAAACGACGGCACTCT
CGGACGCAGAGCAAATGTTGAGCAAGCCTCCGTCGGTTCCTGTGTTCCAGACCTTGAAAGACGAGATCGCACCGCCGATTCCGTCCAGCTTAAAGTTTGC
GGGGAAGTTGGTCGTGCTCTTGTTCTGCGTGTTGATAGGCCACCGGCGCACCTCACCGCCGCTGCAGTCGTTGTCCGTGATAAACGATAAGACGGCGATT
CCACCTTGGAAGAGGCTGCCCTTCTCAGGGAGGCCACGCCAAGTTGCGGACGTTACGACGTCGTTCAGTCGGTCGCACTTGAAGTTGTAGCACACGTCAA
CGAGCACATTCTCGACCCTCAGGAGCTTGTTCTTGAAGTTGGCGTCCTTGTAGAGATCGATGTAGCCGGCTTCAGCCGTCACAGCAAGAATGGTCGCTAT
AGCCACTAGCGTTGCTACCAATCGAGCCATTCTGGAGTGGAAGGTGCTGCCGCCGTGTATAATGGGTTATGAGCAGCATTCGCACGGCCACAAAACTGCA
TCTTATGTTGCCAATGTTTTGTTTTTCGAATATCAGTGGCACTGCGTATTTAGCAGGTTGGTTGTCTCGATATACAGTAGTTTTGATCTGGACCTCGACG
GCTGCAAGTACATTTTGAATCCAAGTTTTTCGAATCCTGAAGGTATTCCATAGCAGAATTACTAATTCCAATACTCCGTCTCTATCAAAATCCGGGGCAA
CAACAAAAATCTCATGGATTGTCCGGACGATTCGAAAAGCTGCTGCCATATTGATTGTCACGTGATGTCGGTATGTCTCTTAACGTGTGAAAACGGCGAA
ACCCTGACTCTAGTTGCTCTCGATAGCCGTCGTGATTTCGTATTATACTTATATTTTGATGGCACCGAGGTCTTACTATTATCGTTCGACCACGACTGAT
ATTGGATGGGGGGTTATCCTTTTCTTGAAATGCATTTTTACTTAGACGTATCCAACGTAGCCTCAACCTTATCGGTAGGCTTAGCTTCAGCCCCCTAATA
GTCTCAAGCAGCAAGTGTGCGACTCACCAGGGCTAGTAGTAGTGAATCGAACTCATGGAATCGTATAAGTAAATATGTTTTTATTGCAGGTGGTAGTTT