Description :
From Genome Similarity Track
Location :
Scaffold_418:5338- 6796
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_418-abinit-gene-0.28Major Facilitator Superfamily (MFS)

Sequence
1458 bases(100 bases per row)
CCGCTGGGGATGCGTGGCCGCATCACGTCGTACCACCAGCTCATGCTGACTATCGGTATTCTCGCGACCGGCATATTTGGTTGGCTCATAGTGGAGGACG
TCCCGTCCGGATGGCGATACCTCAATGGTTTCATTATCGTCCCGGCCCTACTCCAGCTCATCACGGTCTCGTGGATCCCCGAGAGCCCGTACTGGCTCAT
GAAGTTCAAGGGCAAAGACCAAAGTCGTCGCACGCTGATGCGGTTGCGGGATCCGCATAACCGTGATGCCATCGAAGCCGAGCTGTCAGAGATTGCACTC
ACGATGGAGACGAACGCTGTTGCGCGGTCGGCCGAGTGGAGCGACCTGTGGGAGTACAAGTCGGTACTGCTGGTGGGCTCGATCATGGTGTTCTTCCAGG
CGTACGTACTATGGCAATTACTCTGCTCACTATCTGGGTCTTGTTCTGACTGGTCGAATTGATCTTGTCGCCGTAGCATGACGGGCATCAATACAGTGAT
GCTGTACTCTGCCAAGATTTTCCACTTCGCGGGCGTCACGAATCCGTTTCTGGCGACGGTCGTCGTGGGCGTCACCAACGTTTTGGTCACGGTACTCTCC
GTGGCGCTCGTAGATTCCCACGGACGGCGTCCGCTACTGCTCGGTGGCACATTGCTCATGATTGGCTCGTTGCTCGTCTTGAGCGGGAGTCTGTTGTGGC
TCAATGATAGCCTCCACTGGCAGGCCGTGCTGGCGGTCAGTGCTGTGCTCCTGTTCGTGGCGGGCTTTGCCGTCGGACTCGGCGCGGTGGTCTGGGTTGT
GCTCGCCGATATCACGCCAGTCGAGATTCGCTCGCGCGCGTTTTCGCTGTTCATGGGGATCTCCTACGTGTGCAACATTCTCATTGCCGTGTACACGCTT
TCGGCAATCAATTACCTGGGACGCGGCCCCAACCCAGAGAAGGACGGCATCGCCAAGCTGTATTTGATTCTGGCGGGCGTCGCCGCCGCGGCATTGCTGT
TCATTTCGTACCGCTTGCCCGAGACTTCCACGCCAGCAGCGCAGGCGGCTCGAGCTGGAGGAGTCATGAGCGAGGAGCACAGCGCATTGCTGCTGCCCCA
AGACGAGCAGGACGAATACGACCGCAACACCACGGAATTGTAAGAGACAACGGATGACCGTGGTGGAGAATATATGTGACTAGGTACTACGTCGCATGTG
CAGTATGGATGGTCATGCCGGGGTGAGCGTTTTGATGGCGATCGCCAGTTCATTGATGGCCTTGGTGGTCGCCAGCGTGCGTTCGATGAGATCCGTCGGA
GAAATGGACGACGTGAGCTCTTCGAGTTTCTGTGGGACGAATGGTGGAGAGGGAGGAAAAGAGAAATGTCAGTGAGCGTTCGTTAAGCAACCGCCCGCCG
CTTGCCACCAATACAATCGCATGGCCATGCCATGAATGGCAGAATCCGAGGTTGTTGA