Description :
From Genome Similarity Track
Location :
Scaffold_85:53377- 57153
Transcript NameFunction/comments
Phymu_g3847Di-N-acetylchitobiase, putative
Phymu_g3848hypothetical protein

Sequence
3776 bases(100 bases per row)
GTAGTCGAGTGTGTCCGCGTTCCACATGCCTACGCCGCGTAGTCCAAGCTCGCGCACGAGTGCGTACTTAAGTCGGAGGCTGCGCGAGTTGTCGAACCAA
ATCTGCGACCGTCCGCCCTCCGGTGGCGAGTACCACACGAACGGGCCCAGCGTCGTGGGGTCCCAATGCTCGCGGAGACCGTGGCCCTTCACCAGTCGCT
GGACGTCGCCGTAGTCGATCTGTCCACCGGCCGCGTCACTGCAGGGGGCGCCGAAGAAGGGCACTGGCCGCATCTGGCACCACTCTGCCTGCTGGTCCAC
GCACGGGTAACGGTAGCCGTACCACGgcacgcccagcaccagcttctccggTGCAATGTCATACCCTAGCAAAAACTCCTGAAGCCCTTGCTTCACCAGC
GCCAAGGGCGAGTTGGCGCCCGCAACGCACGCCTCGTACACTTGACTACGCATGTCGTACGACATGACGAACAGAAAGTCTGTGAAGGCGGCGAGCTCGC
GCCACGGGTAGTAGCGACCATCTACTCCTCGAGGCGCCCAGGGAACGTCAAACGTAATCTGCAACAGGTCGAGCGTGACAAATGCAAAAGGGtcagcagc
agttgaagtgcagTTATTCCAGTTGTACTGGACGGACAATAACGCACCTGCGCGTTCTGCGTgagcgcgtgctgttccagctcctggcgTAGCTCGCGGA
CGAGCGTGGCGAGGCACCGCGACGTGGCCCCGTGCATGGGCTTCTCTGTATCGATGTTCACTCCGTCCGCGTAGTTCTCCACAATCTTCGAGTACGTCGT
CTGCAGGAAAAAACAACAATAATATTAATATAGATGAGGTCCGATCGCGTAGGTAGATTGCCGTTCCTACCTCGATCCATTCCTGGCGTGCAGTGGCGTT
ACACAGTTGATCTACGTCGTCGAAATTGTGCTTCACCACGACCTTCACGCCTTTGCTGTGTGCATGacagagcagcttcttgtcttcATTCCAAGCCACA
GTTGTGAGCTGggacacacacacacacacacacctCTCAGTACTGTTATCCATAGCAGCAAACGGACCCGCCCAACAACGCAACACTCGCCCTACCTGGT
CCCAGTCGTAGTGCTTCCAGCGGTCGTCTGTCGCCACAGAGAAGGCGAAAACCTCCTTCCGGGGCTTCTTACCGGTAAAGTCAATGGGCAAACACAGCGA
CGCTGAGTTGGAACGGAGGAGTTCGTCACTGTTGTGGCACGGGCAGTCGTGTAGACGAGCGCGGTCCTCCTGAGTCAGGCGGTCGACGAAGAGTCCCTTC
GCGTCGTACACCGGGATGGAGCGAGAGGCGCATTCCCTCGCTGCGATGACCAACAGCAGAGCGACAAGCAGTCGCAGGGGAAGGCGCTGCATGGTCTTGA
AGACCTCTTCGATGGCACTGGCACACTGTACCACTTAAAATATCGCGCCGCTTGGTGCGAAGAAAGTATctttcggtggtcgacttTCGCGTCCCCCCAT
GCGTATAACGCAGCAAGGAGAAGTCAAGACTATGGCTCGACCCAGCAGCGCGCTCCTGATGAGCATGGGGACTGTCAGCATGTGGGGTTTCTCGCCCGCG
TATGACGTGTGCAGCGGCTTTTCGAAGAGCGAGATCGGAAACGTTGCTGCTCCGACCGGATCGGATGCTGGTAGTGAGGAGAAAATGGCTGCAGAACCGA
TCAACGTATTACTGGCAGGGCCTGGGGACGTGCGTCATGTACTGACGACTATCGCGCGTCGTCACCGATGGGAGGAACACCGACCAGTGCACATTTACAT
CTTCGAAAAGGCTATCGAGACCCTGGCACGagacttgctgctgctccaagttGCATTCGATGCGGACGTACCTCTCCGTCAACGATGCAACTCATTTTTG
GAGATATTTGGCAACTCCCGGGTGCAGGTGTGCTGACAGGAATACACAAAGTGCTCGCGCCAAGTTAGGctaacgtttttttttaatcttTTATCAAGGA
GAGGACAAGTGCCTACATCGAAgagcaggcgaagctgctggtggacttcGTTTACAATGAACGTGGCCCATTGGCAGGTCTCGTGGATTTGTCTCACTTG
AAGATGCGCACTCACGATGACCTCATCGACACGTTCCGAAGCTGGTTCCAGAGTGTCAAGTTTGACGGTAAGCCTAAACTTGAAGTGACCTGGGAGATTG
TAGCCACTAACTACCTGGCTGATGCGCACGTGAAGTTGACACGCTTCGTGATCACCGTCTTCGCCACTACTACGAAGTCCGTTACGACTACCGTGACAAC
CTCATTGACTGGGATTACACCGTAAGCACCACAAGGTTTTGGCTTGTGCGCTTGTGCACTAAAACGATATATAACTCAATTCGCTTTTACCCACTACTGT
agatgaagctcaagaagataGAGAATGCCAGTGTGATTCACATCCGTCAGTATCGTGATTGGAGAAACTCCGGGGTGGCGTTTGAATTCGGAGATCAAAC
GTACACAGTACCAAACCGCACGATGGCAGCATACACGGAGGTATAAGTATTTGCAGCGGAGTGAGGTCGGATGGGGATGCTTACTTGCTTTTTAAAATGa
caggcgaagaagaaacaccACGGATCTGTGCTGTGCAGGGGCTTTTGGACGGACATTATATTGAGCCCTTACATTTCGTTCGGTGTGCACTGCGAGATGT
CCAACAAATTTGTGGAGTCGCTCTTCGAGATTCACAACAAGGGCACGGGTGTGGAACAGAACCGCCATGTACGTACATTTGTGTGATTGCATTGAATTTG
TTGATCCTGACTGCTCACACTGGTATCATTGCTTGCAACAGAACACAGTCGAAATTGCTGTTTACAACGTGCTTTCGTATCTGTACGAGATCGAGACGGG
CAACAAGTACCAGATAGAAAAGGTGAAACGCTATTATGCGTGAAATTCGTTGTGTGAAATGCCTAACGTTACGGATCTTCGTAATAGGAGCACGACATTT
TCAGCGGCATCGGAGACGCAGAAGGGAGTTGCATTGATAGTGGCAACCTGCCAACAGCAGCCGGACCGCCACTGCGTTTCGAAGAGCTGGGCGAGGACTC
CAGTCAGTTAAATGCGATCGAAACGTATGTGGCAAGTACTTTTTCTTGAATGATGTATGCCATTATATTCCAACTGCTCTTGCCTTGGATCAGGGAAACC
CACaaacaagaagcagctacagctacagctaaACGACGGACTAAAGCCATCAAGGAATCTTTAAAAGGCGTGAAGGTAGGTACACTTTGCTGCAGAGAAT
TTAGAGTATTAGGAATTTTATTCACTGAAAAACCTTTTCGGTGCAGATCATCCCATTGACAGGGAAGATGGAGGACATtttctccaagaagcgctaCGCC
AGGCTGTTCGACCACGTCTTCGTTTCCTCGCAGCAGTGCCACACACTTCAACCCTCTGAAAgcgtcgagcagcaagcgacACCAGCATTTACAAGCATTT
TGAAGGAGGGTGCGACCGTAGACATTGAGTCTTCTGTGTAAGTACTGCATATACGTCGTCGTATTATGTTTGGCGCCAATTTCAAATGAAAAACGCTGAC
GTGTAACTGGGCACAGGTTCATGCTGCCTCTCCAAGAGGAGCAGCGAGTGCTCTATGTGTCTAAACTGCAAGAATGGGCTGGATGCCATTCACTAGAGCC
TACTTTTACCTTTGGTGGCAAAAAGGAGCCCTCCAACGAGGATATGACCAGGATTGACAATGCCGTCCTACGGTTC