Description :
From Genome Similarity Track
Location :
Scaffold_1102:5337- 6773
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_1102-abinit-gene-0.13Adherance factor

Sequence
1436 bases(100 bases per row)
CATCTCCTTCATCGTGATCAGtGTtGTTGCCCATCCGCATTTGGTGTTGACGGAACGCTTCCAGTGAGATGGCGAGATCcGCTGGGCTTCCACGTCGCTT
CGCAGAGAATAGAGTCTTTTTAATGATACCGTCACTGAAAGAACGCTGCGGTGGACTCGCCTTCGGGATCATAACGACCTCTGCACCATCTGAGAACGTC
TTGTACTCGATGAGGCGGCTACGAACCGGGTCAAGGACATCATCCAGAGAGCGACGCTTTGCGTGAGAGAAGCTCTGGGTTCGACACACCGAAGCATTGC
TGCCGTTACTGCTCCCGCTGCGCACGCTGCTGACATCTGAATCAACGGTCGTTGCGGATGGAGCACGGAGACCATGTGGAGAGCCACCAAGCAACAGCCC
GCCTTCCTGAGGAGCTGGAGTCTTGGACGAGCGGCGAACGGCAATAaCGCAAGCTGTGCAGACTCGAAGTTGTCGCTCGCCGACATCTGGAACAGTGGCA
GTACGtAGCGAGCTGCAGCTGCTGCAGATGACCTCACCACACTTgAGGCAGTTGTACTTGCGGCGTAGAACGCAGAAGTTCTTCTGGCAGACATGGCAGT
GGCCTAGCTCGCTCATTGGAATGACTTGCTGAGGAAgCACAATCTCGTCCTTGTCCGCACGGAAGGCCTCGATGTACTTAACAATACCCATGATACACTT
TTCAACGTGTTGCTGGATGGCCGAGTTGGCGGCCCATGCTGGGAGATCACCGTTCTTGTCGAAGTTGCAAGAATACGTAAGGCGGAGCTCACCTGGCTTC
TTAGTTGTGTGGTACATGAAGCCCATAAGTGGGACGACATCCCGGGTGTACTTGGGGGACTCGGCGTATGGCGAGTTGTTGGGAACGTCAaCTGACTCCA
TGATGCGgAAGGCAATCTTCTGGCCcTGATCATCTTCGATCATGTCAACATACTCCAGAATGATGAagTCTCGGTCTTTGCTGAAGCGGCTTGAGCTTTT
GAAAGCAGCCCACTTGAGGGCGACGTGTCGGTGCGGGTTGAGCTCGTTGGGCTCCACAATGGTCTGAACCACAGCGCCGTCAATAAAGTCGGACGAGAGC
ACtCGCATCATGCTCTTGTAGCTGTCGGTAGTGCTGGTGATCATGGACGCGGCAACGTCTTCAATGTCCGAGTTGAACTTGTACACCGCATGCACATTGA
TGGGCACATCGTTGGCCACATCGGCGCGGAAGAGCGAGATGCCGTGCTTCTCGTGGACGAGTGCCCATGGCAAACCGCCCAGGAGGTCTGTCGCAGCGAG
TAGGTCCTCTGTCATGGCCTTGGCCACAGCCGTGAGGCGCTCCTTATCCTTGAGACTCATGTCGTCGGCGTCGCACGTGACAACGTCGGACGCGCTCATG
TtCGGTCGGTGTGGCGATGTGCGTGCTAGGCTCTGA