Description :
From Genome Similarity Track
Location :
Scaffold_26:533681- 537837
Transcript NameFunction/comments
Phypa_INRA-310PPTG_11167hypothetical protein
Phypa_INRA-310PPTG_11168hypothetical protein

Sequence
4156 bases(100 bases per row)
ACCATCACGTAGGCGTGAATTCGTAAATGCAGGTCCAGCTATTAACGTGGCAGCGTGATGATGTCCGCAAGAGGTTTGGATTGCAATTCGGATTGGGGGG
GGGGGGAGGCTTCATTGCTGCCCTCGTTGGGTACAAAAACCATCGCGTCCAGGTATCGGCGTCCTTCTCAAAATGTTCCCGCATGGTTGAGCCGGGGAAA
AGGCAGATTGAGCCTGGGATTTGATCGCTCACGCCCCACCTCAAATGAAAATTGTGGTACAAGTAACTCGAATTATCAAAACGTCAGCTCTGAGTCAGAT
ATCTAAGACAACGCTGTTTGAGAACAACTAGCCCAAGATGCCCACCAGACAACGTTTCTATTAGGCGTAGCCTACAGAATCTGCAGGGCTCTTTAGTTTA
TTCAACATAAATAGAGGATCTCGGAACAATCAGGAAACACAACAAGAGACACTTGATTACAGCACAAGTGCGGCTGTGAGAGGCTCTGTCAAATTTCAGT
ACGTGTTCTGTAAGGCCCTGGTCGAAGTAAAAATACTGAAATTCATTCTGAGAAATAGCGTGTACTGATGGGCTAAAATTGAGTTGCCACTCGGAACGAT
TTTCAGTTTTTTTTACCGTTCTCAATAGAAACCTCAGAACGCCTGGCAGAGGTGTTCTGAAGTCAGAACAAATTGCAGTCTATACCGGCACTGATCAATC
TTCATCACACTCCATTTCGCGTATTACTGTAAAACCAACGAAGTAGCCATGGTGACCAAGGCCAAGTAGCAGTTTTATGCGTCATACAGTGCATGTGGGC
GACCTTTGCTGCCCTCTCCAGTGATCGTCGTCGATTTGGTGGCTATACTCGAAAAAATGTGAACACTTTCGCGTCGAATGCGTTTGACAAAGCTGTAGCA
AGTCGAAGAACTAAATGGTTTCACAGGAAGATGCGTTGTGATAGACGGACATTCTTTGCCATTGTCACGATAGTCCAGAGCCAGTGGATTGGCAAGATCC
ATCACAGCACCAAGCACAACCTAACGAAACGAGTTACTGTGACGATGGTGTATTTGGCCAGTGGAGGCTCCATGGACAACGCGGCGACAGTACTTGGGAT
GTCGAAGTCAAGCGCTGTGGTATACATTAATCAAGTTCTTTCGGTTCTGTCTAAAATGGCTAAACAAAAAATTACACTGCCATCGACTTCTGCAGAGATT
AAGCGGGTTAGTCTCGGGTTTGAGAAAATCGCTGGTTTTCCTGACGTTATTGGGGCAATTGACGGGTCACTGATCCGAATCAGTAGGCCTGCGGAGCATG
AAGGATGGTACTGTCGGAAAAACTTTCCTGCGGTTAATATGCAAGCCGTCGTTGATCATCAAACGGCATTCCGCTCTTTTTCTATACGTGCTGGGTCAAT
GAACGATCAGTCTCTTTGGAATTTGTCTGGTCTTCGCAACAAATCAACAATTCCTGCGGGAATGCATTTTGTAGGTGATGCAGGGTACAAGATCTTTCGT
CATTTGCTTACGCCTTTTGATGAGGCTGCTGCAGCTCATTGCCCTAAAAAGAAACTCTATAACTACAAGCTCTCTCAGACTCGAATCACTGTGGAGCGCG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATACTGAAAATGATCACGCGATGACCAGGGATCTGTTTCCAGGACTTTCAGCCGAAGAGCGGGCTGAATGGGAGTATTGGCGTGACCATGGCCGTCATG
TCACCGCGTATTATACGAAGCGGTGGGACAATAATTGCTTACTTGCAGTTAATTGTACTACCCGTACCGATAATTAGACGACTACATGTAAATTTCAAAC
GCTCGACGTATTGAGCTGATTTAGTGCAGTTTAGCAAGCAATAAGGAAAGGTAGTCAGCTAACATACATGCATTTCATATAATACTACTACGTAGTATCA
TTATACTTTGGCCCGAGCACTTGGAATAAAATAATATCATTGTCGTCGCTTCCTTAGTGAATTTTGCTAGAAATCGTGCCCGATAGTTGTTTGGTATCGC
CAAATCTCTTTTAAAAAACGATAGATGTATTGAAAAATTCCTCAAGTTTCGTTCAAGAGCTCCGATTACATTTTTATTTCCAATAGGTTAGCTGCATCAT
TCTTTATTGTACGGATACGGCCCATAATATCAGTTTTATGGTGTCAAATATATTGAGTTGTAATATTTTTTCCGACCATGGATTGTAAAAATGCCATCCC
GAATAAAAGACCTCTTCTAAATATTTCTATTTAAATAAAAAAAACTAAATTAAAATACAAGCGGTTTGAAAACTATGCATTTGGTGCAGTATCATATAGA
ACAACTCTTTACGTGTTGACGTGTGCGACGGATTTTAATAGGGCGCTACGTGTTGACGGAGTTTTAGAAAGTTTTCGAAGGTACTTTGAAGGAAACACAA
CCAAGATATCTAAGACAACGCTGTTTGAGAACAACTAGCCCAAGATGCCCACCAGACAACGTTTCTATTAGGCGTAGCCTACAGAATCTGCAGGGCTCTT
TAGTTTATTCAACATAAATAGAGGATCTCGGAACAATCAGGAAACACAACAAGAGACACTTGATTACAGCACAAGTGCGGCTGTGAGAGGCTCTGTCAAA
TTTCAGTACGTGTTCTGTAAGGCCCTGGTCGAAGTAAAAATACTGAAATTCATTCTGAGAAATAGCGTGTACTGATGGGCTAAAATTGAGTTGCCACTCG
GAACGATTTTCAGTTTTTTTTACCGTTCTCAATAGAAACCTCAGAACGCCTGGCAGAGGTGTTCTGAAGTCAGAACAAATTGCAGTCTATACCGGCACTG
ATCAATCTTCATCACACTCCATTTCGCGTATTACTGTAAAACCAACGAAGTAGCCATGGTGACCAAGGCCAAGTAGCAGTTTTATGCGTCATACAGTGCA
TGTGGGCGACCTTTGCTGCCCTCTCCAGTGATCGTCGTCGATTTGGTGGCTATACTCGAAAAAATGTGAACACTTTCGCGTCGAATGCGTTTGACAAAGC
TGTAGCAAGTCGAAGAACTAAATGGTTTCACAGGAAGATGCGTTGTGATAGACGGACATTCTTTGCCATTGTCACGATAGTCCAGAGCCAGTGGATTGGC
AAGATCCATCACAGCACCAAGCACAACCTAACGAAACGAGTTACTGTGACGATGGTGTATTTGGCCAGTGGAGGCTCCATGGACAACGCGGCGACAGTAC
TTGGGATGTCGAAGTCAAGCGCTGTGGTATACATTAATCAAGTTCTTTCGGTTCTGTCTAAAATGGCTAAACAAAAAATTACACTGCCATCGACTTCTGC
AGAGATTAAGCGGGTTAGTCTCGGGTTTGAGAAAATCGCTGGTTTTCCTGACGTTATTGGGGCAATTGACGGGTCACTGATCCGAATCAGTAGGCCTGCG
GAGCATGAAGGATGGTACTGTCGGAAAAACTTTCCTGCGGTTAATATGCAAGCCGTCGTTGATCATCAAACGGCATTCCGCTCTTTTTCTATACGTGCTG
GGTCAATGAACGATCAGTCTCTTTGGAATTTGTCTGGTCTTCGCAACAAATCAACAATTCCTGCGGGAATGCATTTTGTAGGTGATGCAGGGTACAAGAT
CTTTCGTCATTTGCTTACGCCTTTTGATGAGGCTGCTGCAGCTCATTGCCCTAAAAAGAAACTCTATAACTACAAGCTCTCTCAGACTCGAATCACTGTG
GAGCGCGCGTTTGGCATTCTCAAGAACCGGTTTAGAGTCCTCCTGATGAAAGTCCAAATGAAGAGTTCACAAAAAGTGACACAATTAATTGTGAGTTGCA
TGGTACTGCATAACTTGATGATAGAGCTGAAAGATACTTACATTGTAGTCGGAGATGACCCGGATCCAGCCCGTCCTCGTCAACTTTCCACTCTTGCAGA
TGAAGACGATTTAAGCCACGAGCAAGGGGTTGCCAAGCAGTCAGACATAATGGATTACCTCTTTAGATTGTAACTCTGAATTGGTATACTGAATATTCAC
TTGAAGAGGTACAACTTCAACTTCCCTCTTAACCAAATTTGTTAAGAAGCAGCTCC