Description :
From Genome Similarity Track
Location :
Scaffold_5:5336030- 5344055
Transcript NameFunction/comments
Physo_263134midasin-like protein

Sequence
8025 bases(100 bases per row)
CAGTAACCGCGGCATTTTCGCCCGAAGAAACATGAATCTCTGGGGAAAGCCAGCTCAACTGCAAGTCCATAGCGTTATCGTCACCCGGTTTTTGTGAGGA
TACAATGAGGTGCTCAAGATATGCAACATCTCGCTGTAGCTCGAAGTTTTCGCTCTGCTGACACAGCACAACCGTTGAAGGACAAGCAATCATCGGAAGC
ACACGCTGCCTCTGGGAGTTCTCGTGCGAAGTTTGGAAAGCGCGCAGGAAAAGTTCTAGTACCTCTTGGCTCAAGCCAAGCTGTGCCAACAGCCCGTTCC
CATACACACGTTGAAAAGACTCGGCGATGGCATTAAGAGGTGACATTCCACGTGAGAGCTCCGCTGACGCCAGCAAAGACCAATTTTCCAAGTGTCGACG
ATTAATACGACCGTACTTCGCGCCGACCATAAACTCTCCAAGTTTCGTTACCACACGCTCATGAGCAGCTTGGAAAGCTTGAGAAAGGGCGAAACCGGGA
ATTCCACAGGCCAGCGGAATTTTAATGAGATCTAGACGCGGCGAGTCTTCCTCTGCAAGCGCAATTTCCACGCAGCGGTTTCTCATTGCACGAGAAACCT
CACCGTACTGCGCATCCATCGCCAAAAACATTCGGAAGTTCTTGTGCGGCTTGATCACACGAAGTTTGCCGTTAATGATACCGCACTCGTTGATCAGCAT
TTCACCACCAGTCTCCATGAGGGAGTTCAATCGATCCAAAACCGACGAGCTGCAAAAATTGACATTGTCCAATAGCACCCATTCACCCTTCCCCATTGCT
TGGATCAAAGTGCCATCAACCCACTCAAAGCAGCTCGCAATCGACTTCGATTTGCTAAGTTGCACTACGCTGTCAATATCGTTCAGCAAGCCAGCAAGTT
TCGTCTGCATCTCCTCACTGTCAGCTTCCGTTTTTTGGAGCATGGCCACGATGTCCTTCATCAAATCAACAACCACATCGTCCAGGTGACCCTTTGGCAA
CTTTTTCGACTTGCGCGCCTTCCCACTGCTGTCACGAGAGCGCGGGGAAGCGTTCTCGCTGTAGCATTTTTCGCGCGTGATAAGCGCCCACCACGTGCTG
CTAAGGCGGTTTGCCTTTTTCAGAGTCGCCGCTTTCTTCTTTTGTGAAACTCCAGTCGAAGCCGAAAAGAGCATCATTTGCTGCAACACCTTCTCGTACA
CAACTTGAATCTTCTTCTTGATGTCACGGAGCTTACGCCCAACATCCACCTGCTCGAAGCAGCCGAGCAGCTCTGTGGCATCCGTTCCAGCACTCATACC
CAGTTCATGCAGAGTATTACCACTCAATGCCGCCAACAAACGGACAGAAGATGTCTTTCCGCTAGCCGGCGGTCCAACAAGAAGTGCAGGCCACGACATG
TTCACACAGTGCACCAGCGCCTCCATTGGTTTCAGGAGGAAGTTAAACACAGGAGGGGCAACGCGACCGATTTGCATGTCTTCTCGCCTCTTGAGCAGCG
CGTTGCCGATCTCCACAAAACCGGCCGACATGCGAAGGGAGACAGCACTAAGATCCATTGGTTTCACACCGAAGAACTCTTCAAATCGTCGAGAAATTAG
CTCGCGGTCCCGAGCAGAGCGCATCCTTTCCACGTAGATAAAATTCACGTAGTAGCTCAGCGCTTGCAGCTGGTGCTCCGCATTGCTTACTAGCTGCGCC
TGTTGCTTGAGCAGGTCACAGAAACGGAACACGTCGCGCAAGTTAAACTCCCATGGCGCACCGAGGCGAGCGTATCTGCAGTTCACCATTGTGTCTTCAT
GCACCGCCCTGTTGAAACCGATCATTCGCTCGAGCAGGGTCTGACCCACCAGAGCCGAATCGCTCATGCTCGTTTCCGTGACAGCACAGTGTAGTGTGGG
ATACATTGAGCTCGCGATGTGGATCAGATCCTGTTCGTGCAGTGTCTCCACAAAGACTCGGGTAAATCGGTTCAAAAACGACTTCGGCAGTCCCTTACGG
CCACCACCCTGACGAAGCGGGTTTTGAGCGGCAAAGACACGGAAAGTTGGCGGACACTCAAACTCTCGGTCGAGCTCCGGAATGTAGACACTTCCTCTGT
GATCCAGACACGAGTTCAAACCTTCCAGAACAGACTGTGACGCGAGGTTGAGTTCATCGAGCAGCACCCAGTCTCCCGCTTTCAGAGCACGCAAGAAGAC
GCCATCACACCACTCGAACATGCCACTGGAGCCTCCGCCTTGGGATGGCTTGCTGCTGTTGTCATCCGTCTCGTCCGTAGGCGAAGATGCGGCAGGCAGG
TCTGATCCAAAGAGATCGGAGATGTCTGTTTGTTCTGACAAATTGATTCGCACAAGACGATGGCCTGATGCTGCCGCCAAAGCACTGATCAAACTGGTCT
TGCCCACACCCGGGGACCCTTCCAAAATGATGGGGCGACTAACCTGCATCGCGCGCAGAACGCGATACAGATTTGACATCGTTGTGGGTGCCTTCAGCGA
GAAAGCAGGTTTCCTCAGCACAGGATCAGGGCCGCGCGGGATCAGGAACGGCGAAATTCCGAAGCTCCCCTCCGTGGCCTTTTCCGAGGAAAACGAATTC
AACTCATCGATGTTGTTGTCCACAGATAGCGATGTAACATTCAGCGAGTCAATCACCTTTTGCTTGACAATCTGGTCATCATCAGGCACGAGCGCCAACA
AATAGCGGTAGGCCTCCTCTCGAGCCTTCAAAGCAGTGTGCAGTGCCTTATCAGAACCCAGACCAAGACCGTCCAGAATCGAGAGTGCTGCACCTTGAAC
AAATGCCGTCCAAGCAGTCACCGTGACCGACGAATTATCATTCTGCTTCTTCACCACAGACGTGATAAAGTTGATCCAGCTGAGAATGTCACGTAACGTC
ACGGCCCCGCACCCTCCAACACCACCATTCGCCTCGTTGAAGGTTTTCACAAAGCTTAGAATGGGATCGCACAGCGTGGACAGGCCAGCAGATGCAGCTG
GCAGAGCACGAGGTGGCGCCGCAATTCCCCGGGGTCCCACCAGACGATCACAAATAATCGTAGCGATATCATCCAAATCGGAGATCGCCGGCACCCAGAT
TTCTGTGAAACGGTTGCGCAGCGCAGGAGACAATTCGCGCTTACCGAAATCACCTCCAGGATTCATTGTCGCCATCACTCGCCACTTCGAGTGGGCTACA
ATTTCTTCCACTTGGTCACCACCCTTTTCGGCGAGTAGCAGCGTGCGTGAAGGCTCCAAAACACTGTTCAGGCGTTCCAGCACGGCATCCTCTGCAAGGT
TGACTTCATCGATCAAGATCAGGTCGCCGTTCTTCATGGACTCCACTAGAGGACCATCTGCCCACTCGAAGATGGACTGGAACCGCCGCTTCAAGACATC
GATGCGTTCAACAAGCTCCTTCTGTTGTGCAAAGTCGCTGTCCAAGACGCTAGATCTGGCGCTCTCGTATTTGACCAGCATCGCGGCTACACCCTCCGAT
TTGACGTCAGCCCGGCGCTTCTCAACTTCTTGCTCATCGATACAACCGTCAGCCACAGCCAGAAAGTCAATGAGTGCCTCTTCCAATTCGTGCGCAGTTT
TCTCCTTTCCACGCACAGGCCGTAAGCAGCCCAGGAAATCCGAGGTCTCGGTGTGCTGATGACAGTTCAGAATGTGAAGCGGTTGAGAGAAAAGAAGCGA
GTACAACTGGCAAACAGTGGTTTTTCCGCAACCAGTTTCTCCAACAAGCAAGACAGGCTCCTCGTTCTGCAAACAGCGACCGACAAGCGCAAACAGTCTC
CGTAGTGACTTCGTCACACTGATCTTTTCTAGACCTGCAGCATTACCTGCCGATTTAGGCTCACCACTAGACGTTTTGCCGGTTGCAGCTTCCTCAATCG
CTTGTTCCACCATGGCTTGGACACGCTCGAACTGCTCCTTCGTACCCCACACGGTCTCCTGCTCAATCTCACCGTTCTCATTCAACAGGTTCGATTCACG
AGGTTTGCCGCTGTAATACAGGGCATCAAGATCAATCTTTACATTGCATTTTTTCTCCAAAACTTGTTTGACCACTTGTTTCTCCTCATCCTTCCGCAGC
CGCTCGGCAAGCAAACAGTATCCTTCTTCGGCTAAGGCTTGCTTCGTTGCCGGCCGACGTTCAGCCCATCGAAGCAAGTCACGTGTAGTGATGAAGCCTG
ACTTGCCAGCGAAAACGGACGATTGCTGCCGGACAAGCTGCAGTTGGCGCATGATATCAATTAGAATTCCACAGTAAGAGGGAGGCAGCGAGCTTCGCTC
CTGCAGAATAGTTTGAAGCTCACTAGACGCAACCTCGTCCACTTGAATCTCCAAGAATCGATTACGGAACGCGCGGGACAAAACCTTACGACCACCATAC
AAACCAGGTGGATTCTGAGTCGCGAACAACATGAACTTCGGGTGCGGTTTAACAGTCTCTTGTGTCTCTGGCAAGAACAGCTCGCGGTTGTCATCCAGAA
GTCGATTCAGAGCCTCGAGAACCTCTGAAGGAGCCAAGTTCAGCTCATCCAGAATGATCCACCAACCCTTTCGCACAGCCTCCACCAAAACACCCTCCTT
GAACGCCAACTTGCCGTTCGAGTCGGACACGTAACTCCCCATATACTCCTGAATGTCTGTGTGCTCGTGGTTGTTAATGCGCACACATTTCTGTCCGATA
CGCGCAGCCAGATAACCAATCAATGACGTTTTACCAGCCGACGTTGGACCCTGCAACAGCACAGGGTACTTGCCGATCAAAGCTGCTCGAGAAACATGGC
GCAAGTTCTCCTCCACGGACTTCGTAAGCACAAACTTCCGTCGAGAAGTCACTGGGTCCGGCAACGAGTCGTCTCGAGGCGGCTGAAAGTCACCCTTTCG
AACCCAGTAGGAGCTCACTAAGACAAATTCGCTTGTCTGTTTGGAACCACCAGGGCACGGAGGAGAGCGCTTGAGCTCCTTGGCCCTAATCGTTTTCGCA
AACGTGTTCTTGATGAGCTTTTCAAGATACTGACGCGACTCCATCTCGAGCTGTGTGCAGAAGCTTGAGCAAAAGCCTTCAAACATTGCTCGAGACGTAC
CGTAGCCTCGTTGAATCAAGATGCGCGTAATGTGCAGTGCCTGGCTGAGTGTACGGAGAGAGTAGCGGGGCTTGTGGCGCGCACCATCACTCAACCGCAA
CTCTGCTTGCTTCCTCGCCTCCAGGTAAAACTCCACCGTTTCTGGCACCAGAGCGCCCGCAATTTCCTTGAACTGGTGGTGAACGACCATCTGCAAGTCC
GAAGGATTGACGCATTCGTCAACGTAAATCTCCGTAAAGCGGTTGCGGAGAGACGGAGGCAAATCTTTCTTGCCAACGTCCGTCGAGGGATTCATAGCAC
CAAACAGTCTGAAGTTCGGGTGTGGCCGGATTACTTCGACATCACCACGCTCCGTGAGCGAGAATGCACTTGTTTCATGTTCCAGAAGGGTACTAATTCG
CTCCAGCGTATCGGATGAAGCAAGGTTGATTTCGTCAAGCAGTACCCAATGTCCCTCACGCAATGCTTTCACTAGCACACCCTCCACGAATGAAAAGGCA
AAGTGTGATTCAGCCTGTTCTTTTTGGCGCTCAAACCGAATCAGCTCCGCCTCGAAGGTGTCCCATCGGCTCACCAACACACTTGTAGAAGCACCAGGAG
TAGCCATCTTGTTGCTGACAGCAGCCTCCGAGTCTTCTTCATTGCGACCAGTTCCGCCGCTGCTGCTCTGGAGCTTAGAGGTAGCCATCTGGATCGCTTT
TCGCATGCCCTTAACGAGCTTCCTCCAGTCCTTGTGCTCCAGCGCAATTCGAACAACGTTAAGAAATCCAGCGTTACTCTTCTGCGAAAATGTAGCAGTG
AACAGATCCACGAAATCCATGTACAACGGCCGAGCGAGTAGATGAATCTCCACAGGTTTGAATCCGCCCACAAGATCAGAGCTATCGCTCTGGATATTCA
GGTTCTGAACAACCAAGCGCTGTCCCATAGCCGCTGCCATGTGCTGGATAATCGTAGTTTTACCACAACCGGTCTCACCGATGAGCAAAGCTGGCTCACA
GGTTGCAACAATTGCTGCCATCTTCTCCAGCAGCCGAAGAACGTGGCCAGTCATCACAACGGAGCTGGTAGCGGGTTTATCGCCTTGCTCAAGCTGGGCC
TGCTGTGACAAGGTTGGCAGATGCACCCGACCAAACTCCACTTCGTGAGTGCTGAATGCAACGTGAGGTTTGTGCTGCTCGAGGTAATACTCGATCTTTT
CCGCCTGTACTTCCCAAATCGCAGCCAGCGCGCAAGCAGAATGTAAGCGCGTCTTCGGGTCGCGAATTCCAGCGCAAAAAACATCTAGCGCTTCCACAAC
GATACGCATACGTTCGTCCTCAGTAATGTAATCGTGGCTGGAGGATGCGTTCTCTTGAGACGTGCCCGCAGCATAGTAGCAGAAGCGGTAGATGCGTTTG
CACCACTTCAACAGATCGCGCAGACAGAAATCTCGCCCATAATTACGACGTGTCTCCTTCCACAGCTGCACAGGTCCACCGACCTCTTCGCTTGCATTGC
CGGAGACTGCGTTGTACGTTGTCATGATCTTGGACACAACCTGTCGGGGAATCTTCACAAACCGAGTCAGCATGATCTGCTCGATTTCGCTGTCTGCTAG
TGGCGCAACACCGACGCTTGTCCAGACGGACTCCTGGAATCCCTTCGGCATCTGGTGTCCGTGCGTAGTCGTACCAAAGATCTGGAAGTTCGAGTGCGCC
ACCAGCAGTTCGCCACGACCAGGAAGCACCATTTCGCGAGTCTCGAGCAACGGCATGAGCGCCGCCAGGACCTCGAACGGTGCGCGATCGATATCCTCAA
TAACCACCCACCGGCCAGCAAGTACGGCTGTCGTGAGTGCACCAGGTTGCCACGTGAACTCGCCGGGGACGTCAGTGCAGACGTACGATCCTAGGAGCGT
CTTGCTGTCAATTTGGTCGTCCAAGTGCAGCTCAACCATGTCACCGTTGCCCGATAGCCGTGCAAGTTCACGAATCGTAGCGGTCTTGCCGCATCCCCCG
GGTCCGGCCACCAAAATCGGCCGCTTGAGACCAAGAGCAATCGCAAGCGACTGCAAGTTCCGCTTGGTCGATGGAGTCGGTACCAACGGCTCTGTGGCCA
CCGCTGCATCTGAAGAGACCTGTCGTTGCTGATGCAGCTTACTCGTCGGGATGACCACGCCGAAAATGTTCTGCAGCGAGTCATGGAAGGGCACAGGCTG
CGACTCTGCAACGTCGCTGTCGTCCTGTTCCTGGTGTACGCTCAGTTCAATGAGCTGTTCCTGTCGCGTCGCGTCCTCGCTGTGCAGATCCAGTTCAATC
TGCCGCACTGCCGGGCTGTCTCCACTCAAGGCCGCATCCTCGCCGACGCCCAGTCCCTTCAAGAAGTCGTTCCGCTGAGCGTTGCCCATTCTGAGCACCA
AGGCCGTGGCGCGTGCCGCGTACCAGCGCACGCGCGCGTCGTCGTGGAAGCCCAGCGGGAAGAAGGGAGTCCAGTTCCAGAGCGTCGTGAGCTCCGTGGG
CCTCGCCCGCAGCAGCAGAAATGCCGTCTTGGCGATACGTCGCAGCCGCGCGAGGGTCTCGTCGCTCTGCTGCTTCTGCGCAGCCACCACGTCCGCGAAC
GTGAAGAAGCACGGCGCCGTCTCGAAGTATTGCTGCGCCAAGGTGCTGGTGGCCGGCAGGTACGTGAGCAGCTCGGCGAGCGTGGCCGCCAGCAGCTCGC
TCCTCTTCATGCTGTCCGCGCACTCGCGGTACTGCTCCTGTTCTTGCTCGTACAGCGCGAGCGCCGGGTCGGTCAGGCGCACCATCAGGTCCAGCAGGAA
CGGTCGCAGGTGCTTGACGACCAGCACGCGCAGCTCGCGGTGCACGAGGCACGCGGCCAGCGCCTGCAACTGCGTAACGACGGCGTGCTCTTCAACTGTA
GGTTCCAGTGCCTGGAGAGCAGGGT