Description :
From Genome Similarity Track
Location :
Scaffold_111:53358- 54504
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_22338Hypothetical protein
Sappa_CBS223.65SPRG_14045Hypothetical protein

Sequence
1146 bases(100 bases per row)
CACCTCTCTCTACTCGCGCATCGAGTGCACCGCGACGTGCGCCGGTCGATACCTCGGCCACTTGAACGCGCGTGCGCTCGCGGTAGGCAAGGTCGAGCAG
CAGAAAGCACGGGACCTCGCGCAGTGTTGCGCGCGCCTGCATCTCGTCGACGGTTCCCGTGTCGGCAAACACGCCAGCGTCTGCAAAGTGGCGGGCCGTC
GCCTCGTCGCTAGTTGTTGCATCCTACCATGGCATGCCACGCATGGCGTACTACCTAAAGATGGCGCTGCGGAGCGCGCCTACGCATCATTGGATTCTGG
AATGATTCAGGACGGAGCATCCATTTGTACGCAAGAGCGGGCCGTAGAGGCCAACGTCGTTGGCGACATCATCGGCGAGCGCAAGACAGCCTTTCACCCG
CTGCTCCTTGCCAAAGAGAGGGTTCGTCGCTTGCTTGGAGTCGAGGATTAGCTGCTTCAAGCGCACGTCGTATGCGTTGATGGTTGACCGAGGCGTGCTC
CTGCGCCCCTTCATCTCTTCACAAGCGTTTCGGCGTCTTTGGCTCGGTGGACCCAACACGACCCATCGATCGTCAAGCATAGATGATCGATTGGAGCGTC
TCAATTGGAGCTTAGCGTCTCTTAGAGCCACATGACCGACTGCTTAAAGGGCGGTGACGTCAAGAGCTCTTCGTGGCACGCAGCAGGACAACTGTGCTTC
GCGGAAGGAGCGGCGTCGTCTCGCCGCGCCGGGGGCAGGTACTTGTGCACGCGCATCATGGCGACAACGATCACAGCCGGTAGGATCTCGGGCAGCGTGT
ACAGGACCCTAACGATGGTTAGCACGAGTGTCTTTACATGCAGCTAGCACCAGGGGTTCACCGCTTGGTGTGGACACGACACGACGTACAAGCCGGTGAC
GCTCTTGAAGAGGAACGAGACGCCGCACGTGAGGCCGAGCCACCACACGCGGGCGCCCAGCGACTGCGCGAGCGGCGAGAGCTCAAACGACTGCAAGTCG
ACTTTGAGCCGATACGCGCCACGCACCTATGAAACCATTGGATCGGACGAGATTCGGATTCGAGTAAGATCGTAGTACCAAGAGGCAAGCCAGCACAAAG
TAGAAGAGCGACTCGATCACGTCGCGCGAGCTGTTGAGGAGGTTGG