Description :
From Genome Similarity Track
Location :
Scaffold_11:53354- 55371
Transcript NameFunction/comments
Physo_130345predicted protein

Sequence
2017 bases(100 bases per row)
GGAAGCATCAATGCCATCACGACGTGTTGCTTGAGCTGCTCGGGTGACGGCAACAAGTACGACAACCCGCCGTTCAAGATCAACAACGTCAACAGCCACG
ACGCCATCTACAACAAGGGGATCTCCACCAGTGCGTTACAGTACGGCAACATCCGCCAGTACGACGCGCACAACCTGTACGGCATCACCGAATCCATCGT
GACCAATTCCGTTCAGGAGGAGCTGGCCAACAAGAGGTCCTTCGTGCTCTCTCGGTCGACGTTCCCCGGCAGCGGTGTCCACGTGGCTCACTGGACCGGT
GACAACGCCGCTACTTGGAACGACCTGCGGTGGTCGATCCCCACTATCCTCAAGTTCGGACTCTTCGGCATCCCCATGGTTGGTGCCGACATCTGCGGAT
TCTCTGGTGCTTCCAACATGGAGCTTTGCGCGCGTTGGACGGCTCTGGGCTCGTTCTACCCGTTCTCGCGTAACCACAACAACCTCGAAGCTCCTTCGCA
GGAGACGTACGTGTGGCCTGAGGTGACTACCGTGGGCCAGAAGTTCGTTGGCATGCGCTACCGACTCCTGCCGTACATCTACACGCTCGGATACCACGCG
CACGCTGAAGGTCTCCCCATCGCTCGTCCGCTGCTGATGGAGTTCCCGACCGACACTGCCACGTACAGCATCAACTACCAGTTCATGCTGGGCAACGCGT
TGCTGGTGACCCCCGTGGTGAACCAGGGAGCGTCGTCCGCGACCGGCTACTACCCGGCCGGTGTCTGGTACAACATCTTCGACTACTCCAAGATCACCAG
CACCGGTGGATCTGTGACGACGGCGGTGACTCTGTACGACATGCCGGTGCACATTCGCGGAGGAACCATCTTGGCCATGCACCAGTCGGCTCTCACCAGC
ACGGCCGCTCGCCTCACCCCGTTCGACATCTTGGTCGCTCTACCGGCCAGTGGCAGCGCCAGCGGAGACCTGTACCTGGACGATGGCGAGACCGTCAGCA
ACCCGAGCGCCACCATCGTCAAGTTCACCGCCTCGGCCGGTACGTTCACGTCCACGGTGTCGCAGAACGACTATGCGGGTGCTCGCTCGAGTCTGGTGAA
CAAGGTGATCGTTCTCGGTGTGACGTCGGCGCCCTCGAGCGTGTCGGTCGGCTCCATTTCCAAGTACGACTCGGCCACGCAGCGCCTGGAGATCAGTCTC
GCGAATGTGAACCATAGCATCGCCTCGGGCTTCACGATCACGTGGAAGTAAACGGAACTCGTCCGAATCCGCAGGTGCTTCGGGCAGTATCAGTCGTTGC
AGCTTTGGCTCCAAAATATCGCTCTTTCGATGAGGTTTAGCTAGCTTTCGAAGTAAACTAATGTTAGGTTGGACATGTCTTATGAAGTTTGCAGGCGTAT
TCACGTGAACTTGTATTCACCTCCCAACCCGTCCCAGGAATACACCAAAAAGCACAGCAGAACCACTTGGGCATTCATGGGAACATCATCGAAATCGTCG
ACCAGCTCGTAGATTGGCCACAGCTTGATTGCAAGATCGGGAGGGGTTGGCGTCTGGTCCGTGTTCTGTAGTAGAGCCCCCGCAAACAAGTCGACCCCAG
GAATCGTGACGAAATCATCGACTCCATGCCACGGGTTGGCAGGAAACAACTCGTCGGGGGATCGGACGGGAACAAAAGCTGCAGACTTCGTAGTGGTTGG
CCCACTTCCCTCGCCGAAACTACAGATCGAGCGGGGCGCTGCCGAAGCTCACCGCGTCGCCAATCACCACCGACTGACCAGGCGCTTCTCGAAGGTAGAC
GATGGCCACGCACGCAAACGTTCTGTCTTCTTGGCGGCGAAAGAACTTCACCAAGAGCACAGCGCGTAATTCTGGGAGCATGTCGAAGAATCTGCGGCAA
TGGCTCTGAGCTGCCGGTAGGCTTCGCTGTGGAAATTCAACCTCAACAATCAATCGAGGCTGAATGGGGCTGTCTCCAGCAGTTGAGTGTCTCGGGCGAA
GAGCAGTTTCCGGTCGA