Description :
From Genome Similarity Track
Location :
Scaffold_174:53353- 54495
Sequence
1142 bases(100 bases per row)
TCTCATGAAAATAAGCCTTTCTCAATTCGTACAAGACTGAGGCTCATATGGTGAAGTCTTCAATGAACCGACTGTAATAGTTCAGGCTTCCTAGGAAGGA
CTGCATTGACCGCAGTGTCTACGGGAAATGAACATTCTCCAACGATCCCATATCCTTCGGTTCAGCTTCGATTCCTTTTATTGACATTCGGTGCCCGAGG
TACTTAACCTTGTTTCGTCCTCAGACGCTCTTGAGAAGACTGGTTGACAAAATCCACTGATCACATGCTTTTAACAATCTTTCCACCTTTCGATAGAGAG
ACGTCCAGGGTGACGCTGGGATTAAAATGTCATCAATATCAGACCTTCGTCCTAGAACCGAAGGATTTTGGTGCGGGTTTCGCTCGTCGTCTGTAAACAC
ATCGATCTGTTGAGACATATCGTGGTCACTTGACTTCTGCCGATCCCCGATCATAAGATACCCATATATTGCTTTATCCACCATACGTTGATATATCTGC
GACGCGTTCTTCAGCCCGAACGGCATGCGTAGCCATTCATACAGACCCGAGGGCGTGAAGAAAAAGCAGAGATCATTCGTGCCCTTTCTGTCATCTCCAC
AATCCAGAATCCGCTGGCCATATCCAATGAACAGTACCATATCGCTCTGTCCAGATCCTGCAACAAGTCGTTGATCAGGGGCATGGGATAAACCATCAGC
TCTTCAATTGGTTTACTATTCGGTAGTCTAAACGCAGTCGTATATCCACCCCACTCTTTTTCACGATCACTAGGATCGGCGACGCCCATGGCGAAGTTGA
GGGACATATGATTCTTTCCGATAGTAACCCTTTGATCAGGTCCACTAACTTTTCACGAAACTTTGAGGCAACTAGCATTACTCGTTATTGAGGATGCTTC
TTCTACATCTATAATTGCAGATTACACCTCGCGCAGCATGTGGGGGGCATTTCCTTTGTCCATCAGAAGGTGTGGTTTCTCCCAGATCAGCTAACGTAAT
TCCTCTTGCTCTTTGGTCAATGAAACACATGGGTCGCCCACCTGTATGTCGCCAATTTTACCTCGCTCAGCATCTCCTCTACTTCTGATAAGACTGCCAT
GTGTTGGCCAACATCTTCCGCAAACAACACTCCACTTTCATG