Description :
From Genome Similarity Track
Location :
contig_42:533528- 542404
Transcript NameFunction/comments
g7782.t1putative GPI anchor protein
g7783.t1hypothetical protein PHYSODRAFT_553148

Sequence
8876 bases(100 bases per row)
AGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTATGACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGAT
GCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCGTCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCA
CCACCACGTCGAGCGCCTCGACTAGCACCACCACGTCCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACTATCAGCTCTAGTTTCGAGTATAGCGGCAC
CAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGTGACGGAGATGTCCTCTGCACCACTGAAGACGTGTCTCTGACTGACCCTTGGCCCCATGAGCGAG
GAGGTGACGATGGTCTTCCGTGGCCCCATGAACATCTACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACGACG
CCGACGCCGGCACGCAGTCCAACATGGTGTTCATGAACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGACGG
TACTGCCACGGCTACCGAGTCGACCATTTTCGGCGGTTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGTTGT
GAAGTTAACATCATGACTGAGACCAACTGCGCGGACGAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGA
TGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGTCTGCCAACCTGCCCGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGGCTG
CAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGGTGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCACTAC
TACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGACAACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCGGCG
AGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACGACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCTCCGT
GGAGAACCTGCTGAGTTAAGTGGCTTGCCGACAAGTCTCGACTTTGCATTGGATGTTGGAATGAATGGGTATTGCATCAGACCAGATAGTATCGCTCTCT
GCGCGCGCTGGAGATAATACGATAGCAGTGTTATTCTAGAAAAGTGCTGGCCCGATAATAATGTATCATTCGCTGTGTAGTGCCCGAAATAATGCGATGC
TTTCATCGGTCATCATGAACTGGGAACCGTACAAGCAATACAGCTGTGTTGTCTAATGCATTTGCAGCGAGCGAGCGCTGCCATTGTGCAGTGTGAAGCT
GGTGGCACTGTATCTATCGTGAGGAAGCTGCTTCAACTATCAGTACATCAGTTGTTGCATGCCTGTAAAGCTGCTTTTAGTCACCGCCGTCAACGCGCGG
TGATACCAGTGCAGCACTCGCGCGTCGCTGAAGTCTATCCGCGGCAGGAGGAGGAGGAAGGGCAAGGCGAGAGCAAAGCCGCGTTGAAGCCGACGGCAAC
GCTACGAAGCGGTGGACACAATGAGGGTCCTTCAGTCCGCCCCGTGCTCCATGGCGCGCGAAAGATTGGATCGGCTAGACGATGGTGAAACGAATCTGTC
GTGGTCGTCGCTGTCGGCCAGCAGTTTGCAGCAGCGGTTTGCAGCTCCCTGCAAGGGATTGAACTCTACTGGACACCAATTCCTGCAGCTCTCGGTTCGC
AGTCATCAATGCACCCAGAAGACGTTGGGCTGTCGCCACTGGGGTACGGGCGCACGAACAACAGCCTACTGGCTGAAGCATGGTGCGCTCGCAACGCTGG
CAAATCAGTCCCGCATGACATGAGACTCCTGACTCTCGTGGGATCTCTTTCGTACAGCGAGGTAGCCACACAATGTCGGCGCACCACTCCAAACGGATTC
ATGCTGATCAAGCAGAGCGCGACGCAATTAAAGCGCGCGAGAGACTTGCAGGCGCCACAGCGTTAGCCCCATTAGCATATAATACTTACAGCAGACACAC
ACGCTGGCCGAATATCCGCAGGCGAATCAAGTCAAGTTCGGCATGGCGTTTTGGTGTTGCGGCGCCTACGTGTGACTCTGGCGTAAAGTATGTGGATCGG
CTGGGCACCGATTCAGCGTGGGCATACAAAAAACAAGATGTCGAAGGCAAGTCACGAGAGTGGCACCTGAACACGAATACCACAGCGACAGGACGACCAC
CCACCCCGTCTAATTTTGTCCCTTTTAATTCAATATTACAGGTAAGTGACCTCCACATTATGCAAATAGTTACTACGTCTGTTGAAGCCGTCATTTCTGA
TGTCTTCAGAATCCCTTGCCATCATGAAAAATGCTAATTCGCAGGTCAACCGCGGGCAGTCATTTCGAGACAACTAGTTGCACTGACGTTGCAGGGCCCG
CCAGCTGGCGATGGCGTCTATGGCCCAGGGGCGACTATTGCCTGAGATAAGCGCCCGTCGTCATGAAGCTGGCCACCTCGGCCCACGCCACGATGTGTAT
GGCATCCGTCTGTCTCCATTGCTGATCGAACCGATGCGGACTTATCCAGGCACACGAGTCTGCAACGCAACACGATCCCATTCTGCAATTTGCCGACTTG
GCCTCACATCCTCCGTCCCACAATGGTTAAGGTCTTCCTCGCCCTGAGCGCCGCGCTGGTGATGGCCGCCCCCGTGGCCGCGTCCGTGTCCGTGAGCTTC
GTGAACTCGTGCTCATACGCCATCAGTCTCTACGACAACAGCAAGACCGAGAGCATCGCGGCCGGCAGTTCCATGAGCCGCGACTTGGCCAGCGGCTACA
ACGGCATGTTCCGCGACGGCACCAGCGACGAGGCCACGCTGGCCGAGTTCTCCGTCACGGGCGGCTACACGTGGTACGACATCAGCGTCATCCCGCCCGG
AAGCGGCAGCTGCTCGTCCTACGACGCGTGCAAGGAGCTCACGGGCAAGTCCGGCTACAACGTGGCCCTGAGCATCGCGCCCGACACGAGCTCGACCAAG
TCCGTCTCGAGCTCCTGCGCCACGCTCACGTGTGAGAGCGAGGAGTGCTCCGACGCCTACCTGTACCCATCGGACGACAGCAAGACCCACAGCTGCCCGG
ACACGCTGCCCTTCACGGTGACCTTCTGCCCTGGCGGCTCAAGCTCCAGCACAACCACAACCACGACCACGTCGTCGTCTGCGGCGCAACAGTCGAGTCA
GTCGACCACCACGTCGGCCCCTACCGCCACGACCGCCACCCCGGAGGTGCAGAGCGACTACAAGTCGGGCACCGTCATCACGTCGTCGGGTAGCACCACG
ACGGCTCCGACCAGCACCACGGCAGCTCCGACCACGGCTCCGTCGACCAGTCAGACCCAAACGCAGACGTCGACTTCGACCACTTCCACGTCGACGACCA
CGACGTCGACCGGCACCGCCGCGTCGTTCTCGAGCGCGACCATCAGCTCCAGCTTCGCGTACACCGGCACTGATGCCGGTTCGGCTGCTGGCACGTACGG
CAAGGTGACGGAGATGTCCTCCTGCACTACGGAGGACGTGTCTCTGACCGACCCCGTCGGCCCAATGAGCGAGGAGGTGAGTTTGGTCTTCCGTGGGCCC
ATGAGCATCTACAACATCGCCGTGTTCAACGCCAGCTCTGGCAGCGACTGGAGCAAGGTGTCGGCCTACAGCCAGAACGGCACGCAGGACAACATGGTGT
TCATGAACAACCTCAACATCGATACACTGGTGCCGACTCGAGTCCTCAGGGCTACGCGACGGACGACGGCTCTGGGACTGCCACGAGCTCCACGGCGTTC
GGCGGTTCCCTCGCCGACGCGTCGGACTCGTCGGTGACTGGTGGCGGTCCGTGCGTGTCCACGGGTTGTGAAGTCAACATCATGACTGAGACCAACTGCG
CCGATGAAGATGGCTGCATTGGTTACTACGACGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGATGTTCGTGACCAAGGTGCAGATGCCCACGGG
CGATTCCGTGAACCGCCCGGCCATTTGGATGCTGAACGCGCAGGTTGTGCGTGCGAACCAGTACGGCTGCAACTGCCGTGGCGAGGGCGCGGAGGGCGGC
TGCGGTGAGCTTGACATCGCCGAGGTCATTGAGACCAACACGGACAAGGACAAGGTCTCGACCCACTACTACTTCTACGACGGCAGCGTGTCTGCGGGCG
GTGACAACTACGCCTCGCCCCCACCGACTCGGCTGTGACGTACGTGACCATCATCGACAACTCCAGCGATGGTTCCATCAAGATCATCGAGCTGGGCGGC
GACGACTTTGACTTTGACGTGGACGCCGTGACGGCCGACCAGGTGACGTCGTGGTTGTCCGCTTCCGTCGAGAACCTGCTGAGCTAAGCAGCTCCGAAGT
GTCTGGCATCTGTAGCCGCGTAAGCTGAGCTCTGTGGTGTGTTTGCAGTGCCGTGGCATGGCCCCTCGCTGGTTGCGACTAATAGATGAGGCGGTCATTG
CTGTCTCTCTTTCGCTAGAAGCTCGCACGTAACTTGATATCTATACAACGAGATTTTGACTACTCTCTTCGAATCACATCAACCGCACAATGATTGAGCC
CCTTTGCTGCGGTAGTCGTAGTTTCTAGTACCGTTTGCGTTGTCTTGCACTCTGTGGTCGGTGCTTCGCTATCGGATACCGGTGTAGCAAAAGGGATGGT
ACTTCTAAGCGTCCGCCGCACCTGGTATCGTCCCCACACCAAAGTTATTTGATGATAGTGCTGATTGAGCAGCCTTGCCAGGCGTGTAACCCGTTATCTC
CTTGTACTGCTTCACCGTCGCCAATGCGCGATCGCCGTTCACCGAATCGAACAGACCACTCGTATCCACGACGTTGGCCGAACAAGCTCGGCCCAGCGAC
GCACTACAGTCGTCCGCCGTCGAAATACTCGCCTTGGCTGGTTCGGCCAGCATGGGTTCCGCGTGTCTTCGAAGAAGTTACGCACAACCATGCAAAGATT
ATTTCCCCGAAGGGCGTCCTATAGGTATTTAGCTTACAGAGTCTGAAAGGGTTCATGCTGAGCCGGCTACACCATGCAACCTTCCCACCTCCAGATAGGC
ACACGGCGACACAAGGAAACTTTCTGCTTACGTCTTGTCTTGAAGAAAACTTGGACGGTGCGCAGTCGTCATGCAGGTCGCGTGACGTGACATCCGTTGA
GCAGCTCTCGAGTCGACGCAGCATTCTCCTCCAGCCTTACGTCCGCGCTGGGAGGTCCACCAAGAATTATTTTTAATGTGGCGGGTAGCTCCTCAGCAGC
GAACAGCGGGCTGTCGGGACTCCTTTAGCAATCTTCTTCCTCCTCCGCATCCTCGCCTCCGCGGAGGCCGGCGCTTGTGCGGACGAGTGCGCTTGACGGA
GCGAAATGAAAAGTGAGAGCTTGCTGCAGCAGTGAAGTACCCAACAACACCGTCGAGAACACCGTCGAATTGGATGCAGGCGCTGGATCATGACAACAAT
GTTGGAGTGCGTACATGCAGCAGGACAATGCGTGCGGCCAGCAATGGTTAGACTTGACAGAACTGCCACCATGTCTGGACTGGGCAGCAGCTCTCACTTT
TGATTTTGATCATACATTTCGGCAAGAAACCCGGGAGCAGGCCAGCTCCCCTCGCTAGTGTTTTACACTTGCCTACACTGTGAAATATACGAGAGTTCAT
CAAACAATAGCCGACATTCACGTCAGACTTGTCGTACCCTCCGAACATCGGTGAATGAGTCTATTTGAAATTCCTGGTAGACTCTGAAGTAATTTCAGAA
ACATTATAATATTTTAAAAAACAGCAGTTTCGCTCCATCCTAAAGTTACTTTACTAAATGTAATATCAGTACTATCTCATTTGTTTTTGACTCGAATGCT
ACGAGCGCGAGCGTAGTTGCTAATGACCATAGTGGAGGTCACCCCACGAGTGAATGGTACATTACATAGGACCACTTGAGCAATTTTCCGTACCTTGCGC
TCAGTTAGTAGCACAAGGCCACCAACAGACTTGTCCACCTTAAACCACGGTAAGTTTGCTCATTCTCCACGCCCTTCATTAAGTGCAATAGCCTCTGTTG
TTCGGCGTATGAAGTGAGCCAACCCACCTGCTCGTACGCCAAGCTGACTGTGACGACCCGTGTGTGGCCTGTGGCCGTGACGTCCTTCACTTTTGCAGTA
ATGAGCTGGATGACTTCAGTTGTTCGTGTCTGTATTGCCCGTGGTGGCGATATGTTCTGCTAGTGGCACCCGTACTTTCGGCTTATCTTGATCAAAGAGT
CTTGTGGAGGAGGCGCGCTAGAAGAGAGGTGTCGCCCCCCGCGGTTCGGGCAGGCGGAAGCTTCTAGAAGCTTCCACAGCTGCCGTACGTCTGCCTACTT
GTATTCACGTAAGTTTACTATATCATATACTAAACTTTAATGTCTGCACTACTGTTTCAAATCGGCTAGCACCCACCCTTCTATCTGGCCGCGCGCCCCT
CTGGCTTCAGCATTTCCCCACTGAGATCGCTTCGCGTCGTCGCTGCTACTGAGGATTCGTCTGACCCTCCTGCCCCATGCTGCTTACCGGGCGGCCGATT
CTTGAGGGCTTGAATAGGTCTCTCGGTTGACGTTGCCTTCTCCCTGCGATGCTTCGTGCTGGAATGGCGTCGCCTCCTCGAGACGATGTGGAGCCTGCTG
TGCCTGCCTCACCACCTGATACGTTTCCTGCTCAGCTGGCACTTCCCCACGCACCTGTAAAATTCACCTGTGGTTGTTCTTGATGAAGATGGCGACCCGG
ACTCAGATATCGACGACGATGACGCTGTGCTTTGGATTGCCATGCTTCGCAGGATTGTGATGAAGCAAATTCTCGAGCAGCTCAAGGCTGAGAGACCAAA
TGAGGACCATGGTAGCGAGGGACGGCGCTTACACCACCCACGCTATGCACCAAGCTTTGCAGAAGCACTGAAAACAGCTTGTGTTCATGAACAAGATATT
CAAGTGCAAGAGCGACAAGCTTGTCAAGAATGCCATCAGGTGCAAGAAGCATGCTCTCTTCATTATTGGACGGCACCCTGGACAGCAGGAGGGTTCTTGG
CATTGTATTGCCAGAGCCACTGTCGGTAAGAAAAACCTCTTCATTGAGTCCGACAGCTACATGTATTTTCCTAATACTGTAGAGAAGCTTAGCTCATACT
TTGAGCACGTTGACGGCGTGTACGTTATCGAGGATATTGTGCAGTACGGAGTACCAATAACTGGTACAATATATTTCCTTTCACTTGATTGCTTGTTTAA
ATACTCTTGATTATTGCAATTAATGTAGTGTGGTTAACATGAAACGATGAGTGATTGCACATAATTATTACGCTAATTTTTGTAGAAGGGTTAATACCTT
TTTAGAAAGGCCATTACGCAGGCGTAGAAAAGTCGGCTTTGCAGGTGACTTGGCGAATATATCTTCCACCATTTCCTTAGTGCTACAATATTTCATCTTC
GCTCTACATTTTCTTGTACGAAGCAGTAGCGAATAAGGATATGATTGCTTCTATCATGAAGTTCTGGATTATATGAGAGTTTAATACAGCTCTGGTTGTC
GTCGTAGAGAGTGATGACATGTGGGCTACTGTGGTCTAGCACTATCAGTAGGAGTTTTGAGAAGATGACTTCCTGCATGCAGTGGCATAGTGCGACGTAT
TCTGCTTCAGTTGTGGATAGCACGACTGTGTGGTGTTTCCTAGACTGCCATGAGATTGGATTGCCACTTATGTAGGTAATATGTCCTCCTACATATCGAC
ATTTTTCGGCGCAGTTATCATAGTCTGCATCAGAAAAAGCTGTGAAGTAGCGCTTTGTGTTATATTGCTCCAGGTTTTCCTTTCCTCCAAGGATAATGCC
GAGGTTGCGTGTACTATTTAGGTATCCACGGCTTCTCTAAACCGCATTTCAGTGTTGTTTTCCTGGATTAGCCAGAAATTGATTAGCTTCACGTAGAAAA
TAGGCTAGGTCTGCCCATCACCAGGTACATGAAGCTACCAACCGCCTTTCTGTACGGAATCGCCTTCATCTCATCGTGTTCCAAAGGAGTTTGTGGGCAC
ATATCTAGAGAGAGTTTGATAGTCAGATCAGTGGGTGTTTCCACTGGATATGAGTTTAGATGGAGAAGCGGTCCAGGACTTGGTAGCGTATTTCTCTAGG
TAGATGGAGCGATTTTTTACGATCGCGTACAATGGACCACCCTAAGAGGTAATGGGCTTCACCCAGGTTGGACATTTTGAAGCGCTGTTTGAGTGCGTCC
TTGATATAAGTGACAATGTCAACTGTGGGTGCAATGATGAGAAGGTCGTCGACGTAGACAGGAATGTAACATGTCTATCCGTCATTTTCCCCTACAAAGA
TGCTACTTCATCGTAGCTAAGTTGTCAAGTGCCAGATTCGAGGGGCTGTTTAAGGCCGTATAGACTCTTCACCAGATCGCATACGAAGTGTTCTTCACAT
CGGCGAAAGAACCATTCAGGTTGTTCCAGGCATATTTCCTCATCTAATGGAGCAGCGATGGTAAGAAGCAGTCGTAGGACTTCCATGCGGATGGGGAGGA
AATCTCGTCGTAGTCAATCCCTATCTTAGAAGGACACCCTTAATAACTAGGCGAGCTTTGTAGTGATCTATTGTGC