Description :
From Genome Similarity Track
Location :
Scaffold_24:53349- 56762
Sequence
3413 bases(100 bases per row)
CCAGTGATGGTCGCCGCGATTTAAATCGACATCAACACGTTCACCCCCGCCACCGTTCTTTTATCTGTCAGCGTAGTGTTAGCGCCTAATGCCGACTGTT
TACACAACCAAGGGTACAGCTTTCTAAAACATTTCGTGCTCAGCACTGTGATAAATACACTACGGCTTAAAGCACACCCAGACAGGTGCAAACCCCAAAG
GAAAGTGGACAGCATCATCCAAAAGGTTGGAAGCTTATCGCATATCCTAGCCCCGCTCTCCGCAAGAATTCCATGCAAACAAGCAAAAGGTGACCTAACT
TGCTCATAGCTAACTCGAAAGCGTCAAGCTTGCACAGTCGTACGTCCCCGCAAAGCAGCTTCAGCCAAACGCACCTGGACGACCTTTGTATCGGTATCGC
TCTTTCCGCGTTGTGCACTGCTCCACCGGTAGCGTGGTATTTTACAACATTAGGATGGTGGCTATTACCGCCTTTGTGCAATAAAAACGTCGACTTACAC
TTTCGTCGGGTGCGTGCATTTCACAACTGACCCGGGGACCGAAGCAACCGCAACCTTTGCAGTGTTACGGTCTTGCAAGGTCATGGGCCAGTCGTGATAT
TGCCTGTATCTAGAAGCCCCGTATTTCTCTCGGTGCACCAGAAAGAAACGCGCATAGTCTCACGCAAATTACTGCGGAGTTTGCTTGCGGCGAAGCCATG
TCTGATGGCGTACTTCTTGGCGGTGTCAACGGCTTCTTTCTCACTACTGAACGGCCCGGATGGTAACCTTCATCCCAGCTCCATAGAGTAGCAGCTAGGA
ATAGCATCAATAACAACAGTAGAAGCTGCCATGCCAGAGAATGAAGGTGAAAGGGATCAACCCTTCTTTAATATCCCCTCATCATTCTCATCATAGTGAG
AATGATAAGGGGATATTGAAGAAGGAACGGTCGAATCCCATGGCCCGTCGCTTTACCCTGTTGGCAATACAATAATTAGGCATAATGGATAGCCGGCACA
GTTTGGGATGGGCAAAGCAAAAAAAGCCGAAAATGTTAGTGTATTCAGGCAAAAATGTTAGTGTATTTAAAGTCTCCCGATAAATGAGCATGATCGGGTA
CGATCAGTAAATGTCCCACTGTATCTGTCTCCTTTCTTTCGCCTCCCCATCTCCCCGTTCGTCTCTACCATATGGACAAACCAAATGCTAGCATATAGCT
CAAAGGACAGTGACTTTCGTCACAACGACTGTTGCACGATCTGTACGCGCCTTCATGCAAACGTGAGGTATATCATGAGCTAGACGTAGTTCGCTGACTG
TGCAAGCGCTAGGATTAAGCTGGTACAATATTCCTTCTCTTTGCATTGCTTGTAGTCCCATACAGCACCATTAGGTGGGGTGACAAGAGTTGCGCTTTAA
ACAGGGTGCAAGAGGAAGACTTCGTGATGACAAGACAGGCGAACCAAGGATACGCGAACTTGGTAATAAACATGAACGGCCGACTACCGGCATCAACTGA
ACCAGCACGAATATGTGTATGGGCGGTTTCATATGTATCCACCACGTAGGGTTAGCGCGTCTCCAGCAGTGAGTATAACTTAACTTTTGGTGCACCAATG
AGAGATCAGGATAACTTCATCTCAAACTTATACGCAGGTATAACCATATAATATAAGGCAATTTCGGCTGAACGTGACTGGTGAAGTTGTGGTCGCCTTT
GTCTATTATTTGGATTTGAGTTACGTTCAACGATATAATGTTGCTAGTGTCAATGAAAAAACGTCGTGTCTGCAAAATTATCTTTCTCTATATTAAATAC
AGCCAATGGTATGCAACTAATCTTCGCCTATGACCTGGAGATCTCAAAATCCTGAGCCAATGACATGCAGCCAGAAAAGTTATTCTGGGTGTCGCAGAAC
TACAAAACGCCGGCGGGATAACGAAAAAATAACTTTTCTCGAGTTATCCCCGAGTTATTTCGCTGCTGTGGCGCACTTTTATGAGTATAACTAATAAGGT
TTTTTGATTGGACAGAAAGTTAAGTTATACCGACTGCTAGAGACGCTCTTAGAGCTGCCCTTGTTGTTGCAGTGATTACTGCTAATACGTGATACTCGCC
CAGATTACAATAAGAGTCGAGGCTGTCTGTTGTCACAACGATCGCTGTCAATGCGTGGTACTCGTCTCGAGAAACTGCTTCAGACAGTTGAGGATAGGGC
CACTGAATCGACCGACCAACAACTGATGCGAAGATTTAAAAATATATGAATACTAGCGATTAACATATATAATGAACCTGCTAATGTATACATAAAAATC
ATGCTTCTATTTTACGTTCTCTTGATTCCCAAATTCCAATAATTTAAAAATTAGAGTAAATACACTTTCAATATAATAAATTTTTAATCACGTAATTATG
TTACAACTAAAAACAAAGTTTTTAAAACAATATAAATTAAATCAATTACAAACTATTAAACGAGCTTTAAATACATTTTTTGCTATAATGATTTAGTATT
AATAAACTAATTTTTCGAAGTGCATGGTGTCAAATGTGACAAGAAATGGACCGACACTTGTTGTTGAATGTAAGAAGAGTGATACATCGCTTCCCGGTGC
ACAGCTGCTCTTCTGCGAATTTTACGTTCGCGAATAAATGATGACACACGAACTGATGGTCGAAAGCTACGACAACCTTTATCTGACGAAGCCGTGTTCA
AATAAAAGCTGAGTGAGCGGTTGATGTCAGAATGTGAATACGCGTCGTTTATAAAGAAGTCATGTCTTTACATGCTCATCACGCTACCTCTACATTTACT
GGATTCGTTCCCGCGAGACGACAGATTGCGCCGTTGATAGCCTGACGACGACGGCTACTGGCTCAATTATTACCCAGGTTGAAAAATCCAGTCGTTGCAC
GAGACATCTTATCGACAAAAACACTAATGCAAAGTCTTACATCGATTGACCCCGTCGTACGTGATCACAGTTATTCGGAAGAATGCCACTGTCCTTTTGG
GGCGCGGCTACTTCGTGACTTAATGCAAGCATTTGATGTTTCCTTGAAAATTGAAGTACGTAATGACACCGTGGGTTCACATCCCACTCTATCTGTGATA
ACCCCCCCCAGCTAACTTCCAAAAAACAAAAAAGGCTGGTCGACGAACGGGGAGATGGGAGTGGTGGGCGAAGGGAAGGAGGAGACGATCTAAAATCTCC
TTTAAAACACTATATTTCCTCTCTCGTAACTCCAGTACACAACAACAAAAATTACATAAATGGTGCTTGAGTCGTGCTCAGCGATCCCACTCACCACCCA
AACACAAAATTATTGTCGACGTGAGGTGATTGGAATGCGTCATGTAAATGCCATTAATGATAGAGTTTAGTGTTGTGTGGTTCACCAGATCGTGACGAGA
AAACCACTGTCGA