Description :
From Genome Similarity Track
Location :
contig_42:533464- 534724
Transcript NameFunction/comments
g7782.t1putative GPI anchor protein

Sequence
1260 bases(100 bases per row)
CTGAGACCCCGGTTGCCACGACTGAAGCTCCTGCCACGACTGAAGCTCCTATTGCCACGACCGAAGCTCCGGTTGCCACGACTGAGACCCCTGCTGCTAT
GACCGAAGCTCCGGTTGCCACCACGGCCACGCCTACGGTCACGACCGCTACTGTTGCCTCGGATGCCGATTACAGTGCCGGCGTTGTGGCCACCGATTCG
TCCTCCTCGACCAGCACTTCGACGTCGACCAGCACCACGGCGACTATCTCGAGCGGTTCCACCACCACCACGTCGAGCGCCTCGACTAGCACCACCACGT
CCAGCGGCTCCACGGGAGACTTTTCGAGTGCCACTATCAGCTCTAGTTTCGAGTATAGCGGCACCAACGCTGGTTCGGCTGCGGGCACGTACGGCAAGGT
GACGGAGATGTCCTCTGCACCACTGAAGACGTGTCTCTGACTGACCCTTGGCCCCATGAGCGAGGAGGTGACGATGGTCTTCCGTGGCCCCATGAACATC
TACAACATCGCCGTGTTCTCTGGGTCATCCGGCAGCGACTGGAGCAAACTGTCGTCGTACGACGCCGACGCCGGCACGCAGTCCAACATGGTGTTCATGA
ACAACCTCAACATCGACTACACTGGTGCTGACTCGAGCCCGCAGGGTTACTCGACGGCTGACGGTACTGCCACGGCTACCGAGTCGACCATTTTCGGCGG
TTCCCTTGCGGATGCCTCCGACGCGTCGGTGACCGGCGGTGGTCCGTGCGTATCCACCGGTTGTGAAGTTAACATCATGACTGAGACCAACTGCGCGGAC
GAGGACGGTTGCACCGGCTACTACGATGACATGGGCTTCCACGGCTGGGACGGCGGCATGAAGATGTTCGTGACCAAGGTGGAGATGCCAACCGGTTCGT
CTGCCAACCTGCCCGCTATCTGGATGCTGAATGCCCAAGTCGTGCGTGCCAGCCAATACGGCTGCAACTGCCGTGGTGAGGGCTCGGAGGGCGGCTGTGG
TGAGCTTGACGTCGCTGAGGTCATCGAGACAAACACGGCCCAGGACAAGGTGTCCACTCACTACTACTTCTACGATGGTAGCGTGTCCCCCGGTGGCGAC
AACTACGCCACGCGTCCGACCGACTCGGCCGTGACGTACGTGACCATCTACGACAACTCCGGCGAGGGCGTCGTGAAGATCATCGAGATCGGCGGCGACG
ACTTCGACTTCTCGGTGGACTCGGTCTCTGCTGACACCGTATCCACGTGGCTGTCCGCCT