Description :
From Genome Similarity Track
Location :
contig_5:533445- 537474
Transcript NameFunction/comments
g1384.t1Serine/threonine-protein kinase PLK4

Sequence
4029 bases(100 bases per row)
CTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTCTCGAGTTTGCAGGGATCGAAC
TCTCGCGTCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGGCTAGAGGGATGCACAGCCAGC
AATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAATTCCGCTGGATGAGAAGATCGA
TTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACGCTGTCGGGACTGGTCAAGATC
CTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGCTGGCTGAATCGACTTTCAGAG
AGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTGCCACATCACGTGTGAGCAATTTCGGGAATTTTGTGCTAAGAAC
AAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGACCGGGAGGATTCAATGGAGAGTA
CTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCATCAGTGTCGTCGGACTCGTCAATAGTCGTGGATACACCGATGGATGTTATGCTTGATGACGTCGGT
GATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCGATTTCTAGAGGAGCCCCACTGATCTCAGTCCAGCTAGA
CTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGTCGGTGGCAGAGCTGGACGCTCCGAAGAGATTGTATAC
CCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATGTGTTGAGTTTATGTCTGCATCCCC
GCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATGTGTGGGATTTAGACACAATGGAGACCCAATGCATTTTGCAAGGGTTTCAC
AAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGCATTGCAATCTACGAGTCATCCAGCA
ATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGAGGACACCTAACGAGTTTGTTACGTG
TGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAAAGGATCTCTGCAACCGTTTCCCGTG
GCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCTCGGCAATTGACATCCGTCATTAAGG
CACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCGCTCAATGGGATGATAAGCTCAAACA
AGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTGTTGTTATTCGCCTGATAGACGAACT
ATCGTCGTTGGGACACTAGCGTCAGAGATTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCACTCACTAAAGGACACTTTCAAGGCGA
ACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTTGGGACTTAGCAATGCAGCATGAGTTG
GGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCTTGGCACGGAGGAATCTGGCAAGACTG
GAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTACAGTGCGATGGATTTAACCTGTGCAAA
GGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCGCAAGCCACGATTCCAAAATCTATCTG
TACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTTCTCACTGGACGGGAACTACTTACAGA
GCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTTCGGGACGAATTATGGCACACTATGAC
CTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATCGATCTAACAACGGAAAGCTGTTGGCA
ACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCTGCGTGGGCATGCTTCTCACGTCACGA
ACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAACATGACCAGCAGCCCACAATGGAAGA
CGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTGAAGACCCTTTGGAGGTCGTGGCTACG
AGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGCTTCGCTGAAAGTGGACAACACGTCTC
CGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGATTCCAACGGCAAGGTTGTATATCATAC
TGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCGTCGCATTGTGTCCTCATCCGAATGGT
ACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATGTCTGGGACTCAGTGAGCGGAGCAGCTGTAGCTCCCTGTCTGGAAGGATTTCATCAG
CGTTTTGTAAATGTTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCATTCCATTGCAATTTACGCTTGGCAGAGTG
GTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGGAGTGGGTGACATGTGGTGACAAACATAT
TCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAATGGAAAGGTTCCGTCCGTCTTTGACTGT
GTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTTGATTTGACAAAGGCAGTACCGGCACATG
ACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCGTTTGGGATGCCCAGCTAAATAAAGTGG
CTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTCTAACCGAGTTTCTCCTAGAGTTTTCTT
AGTTGGAACTGGCGGGAGCGATCTACTTGAGCTCGATGCTGGCCGCGCTCAACCAACTTTGTCTACAATCACACGCGGACATTTCAAAATGGAGGTCTGG
GGTCTTGCGTGCCACCCAACCAAACCTGA