Description :
From Genome Similarity Track
Location :
Scaffold_137:5334- 6880
Transcript NameFunction/comments
Hyaar_Emoy2810777putative polyprotein

Sequence
1546 bases(100 bases per row)
GAATCACCAATTTCTCATCGTCGTCAATTGTCTCGCCAACATCTACGAGCTTTAAACACAGCTCATCAAACCGCAAGAGATGATTTATTAAGCTTCCTCC
TTCTTTGATCTGTACCTTGCTCAGCCTTTTTTCGTAGCTGTACCTTATTGTGAAGGTTCTGCTGTACAAAAAATGAGCGAAGTGTATCCCACGCATCATA
CGCAGACTTGCACTTCACGATGATATCCAGAGCCTTTGGATCGTCGGTTTTCCATGTGCTTGACTGCTGCAAGGTATCTGGCTTCTCCAACACGTGCTCG
AGAACTCGTTTTCGAGCAAGTTCCATCCACGTGGTAAATTCCCAGAGGAAGTAGTTTTCATCGGTGAGCATATCACCCGAGGTTACCGAGATTGGGATTA
TAACCTATAACACTTAGATACCCGCTTGTCACAAAATGGAAAGTGAAGTATCGTTTAGCCTTCTCTGTCGGTCTCACCTACTTGTTGTAGTACGCCCCCA
GCTGACGACCGCAATATCATCGGCTAAATCTCGTGCCTTCCAGAAGATCAAATCCAAGTGATCTATTCGTGGTGAGTGATGGGATTGGAGTTGGGAAAGT
ATGAGGGCACTATCTCCAACGACATGTAGGGGGGTATAATTGTTCTCCTTTGCCTGGCGTATTACATCATGCTCTATGAGCAGAGCAAAATATATAGACC
AGTGAGTTTCGATAATTTACATACTTGTGAAATTGCAGACAGCCCTTTCTGACGCAACTTCCTATGCCGTGGACAAATATGGCACGTTATGCTGCTATTT
GTGAAGAGTTAAATGACACGAGAAAGATCGTTTGACCAGCACAAGTAGTTTGGGACCATGTAGTCGTACTGAATCGGGATATAGCACAACGCATTTCGGT
ATTGAATAAATGTTACAAAAGCGATGTCCTCTCCGCTTTGTCGATATCCTCTCCGGTAAATGTCAATCCGTCAGCTTTTTCCTTACAACGGAGTTGCGAG
GTCATATTGCTTGTGACACTGTGATAAATACAAAACGAAGTCTGCAGAATTCGAATTCTGCTACCACTGACGCAACATTTCGCTTGCCTGCATGTTTGCC
CAACACGCGCATCCTTTGTGTTGCGGCTTACATCGACTCTCTGTGGATCACGTCGTAAAGTACTTAACATTGTAAATTGATTTCCTGCTTACGAAGTGGT
TGCATTAATGACCCCCCGGGGCCCCAATCATTTTAGAATACTCGGTCGTGTAGTGCAGGCTGTGGAGAGCTCATTAAATGCCGCAGAGACAAACAGACCC
CAAATTGCATTGTAGATCTCCAAAGCTCCACGCACACTTTTTTACCACATAGTATACTCACAGGACGCACTAGCGCTTTCATGAACTACACAAACGAGAA
TTTTACGTTTTATGCAATCCGTTTGCAGCATTTCGGGATCTTGATTCATTGCTTTTGTCGATTTCGCAATGGTGGACTCCTCTATGAAGATAACTTCTAT
GTAAACATTTTGGGCGTCAGCGTAAAGCACTTTGCTCGGCCTCACA