Description :
From Genome Similarity Track
Location :
Scaffold_165:53339- 54750
Transcript NameFunction/comments
Physo_144087PREDICTED: similar to RNA binding motif protein 34

Sequence
1411 bases(100 bases per row)
CCGAAGCCACGGCCTCCACCGCGGCCGCCACCACGGCCACCGAAGCCACGGCCACCGCCACGGCCACCGCCACGGCCACCGTCGAAGCCGCCACGGCCAC
CACGGCCACCGCGGCCACCGCCACGGCCGCCACCGCGGCCTCCGTCGAAGCCGTTGTTTTCGCGGCTCTTGGCGTAGTTGACACGGATGGCACGGTTGTT
CAAGTACTCGCCAGCGAGCTTGACAGCCTCGTCCACAGCCTCGGTCGTGGCAAAGTCAACGTGGCCGAAACCACGGAACTCGCCGGTCTCACGGTCGGTG
GCCAGGCGGCAGCTCGTGATCTCGCCGCACTCGCCGAAGAACTCGCGCACGGTGTTCTCGTCCACGTCCCAGGCGAGGTTGCCGATGAAGATGCTGGTGC
AGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATCTTCATCCAACGGCCACCGAAGTCCTGGCCGTCCATGGCAAGAGCAGCCTC
AGCGGCCTCGGCGGTAGCGAACGTCACGAAGGCAGTGCCAGACGAGCGGCCGTTCTGCATCGGGATGCGGGCAGCAGTCACCTCACCGCAGCCAGCGAAG
TGCTCCTTGACCTCGTCCTCCGTGGCGGACCACGGCAGGCCGGCAATGAAGATCTCCAGCGCCTTCTGCGGGTTGGCCACAGCGGCGGGCTCGCCGTCCT
CCTGCTTCTGCACCTTGTTGGACTTCTCGGCAGCGTCCGAGTTTTTACGCTTCTTGGACACAATGGGGGTCTCCTCCTCATCCGAAGACGAGTCCGAGTC
GCTGGACGACGACGACGAGTCCTCCTCCTTCTTGTCAGCAACCTTCTTGGCAGCGGGCTTCTCAGCCTCCTCGTCGTCCGAGGAGTCCGAGTCAGACGAA
GAGCTGTCGCTCTCCTCCTTCTTGGCGGCAACCTTCTTGGCGGGGGCAGCCTTCTTGGGCTCCTCCTCCTCGTCCGAGGACGAGTCCGACGAGTCCGAGC
TCTCCTCCTTCTTAGCAGCCTCCTTCTTCACGGGGGCAGCCTTCTTGGGGGCCTCCTCTTCATCAGAAGAAGAGTCCGAGCTCGAGTCGGAGCTCTCCTC
CTTCTTGGCAGGCACCTTCTTGGTGGGGGTGGCCTTCTTCTTAGGGGCCTCTTCCTCGTCCGAGGACGAGTCCGAGCTCGAGTCGGAGCTCTCCTCCTTC
TTGGCGGCCGGCTTCTTGGCCACCACCTTCTTGGGGGCCTCCTCCTCGTCCGAACTCGAGTCCGACGACGAGCTGTCGCTGTCCACGGGCTTCTTGGGGG
CGGCCTTCTTGGCCACGACCACCTTCTTCTGCGGGGCCTCGTCGCTGCTCGAGTCCGACGAGCTGCTGCTGCTGGACGCAGGCTTCACGGGGGCTTTCAC
CTTCTTGGCCA