Description :
From Genome Similarity Track
Location :
contig_5:533324- 540465
Transcript NameFunction/comments
g1384.t1Serine/threonine-protein kinase PLK4

Sequence
7141 bases(100 bases per row)
ACATGGGCAACGCGCTGCTGGTCGCGTCCGTCAAGGACCGCCAGGCGGTGGCACTGGCCGATGCCATCCTCCCCTTTGACAACCTGCGGCTGCGCGAGAT
CGAGGCGTTCTGGCGCGCGTTCTACGACTCGGCGACGAGCTTCGCGCTGTCCAGGAGCCAATTGCGCTCCATCTGCTGCCGCGCAGTGGCCACAGGCGTC
TCGAGTTTGCAGGGATCGAACTCTCGCGTCGCCGAGTATGCTGACGCTGCCTTTGAACTATTTGCAGATCCTTTTATGCAGAGAAGGTGGCAGCCAGGGG
CTAGAGGGATGCACAGCCAGCAATTTTCAGCTTCCAGCGATAGTTTGGCGGCAATTGACGCCCTCGAATTCCTTTCGGCTATTGCGTTCATTGCTGCAAT
TCCGCTGGATGAGAAGATCGATTTGCTGTTTGATTCGTGGGATATGTCGGAGGACGGAGCGCTGGACTTAGATGAGTTCACGATCTCATTGAAGTCGACG
CTGTCGGGACTGGTCAAGATCCTTCAGCCGGTTGGCCCTAATCTTGCAGTCAGAGCGGCGAACTCGGATACGGTGGTCAATGAAGAGGAGATTGTGATGC
TGGCTGAATCGACTTTCAGAGAGATCACTACCTGTGGAGTCTCGTTGTCGAAGGAGAAGTTGCCAGCGCAGGAGACTGCCACATCACGTGTGAGCAATTT
CGGGAATTTTGTGCTAAGAACAAGCGGGCAAAGGAACTTTTCGACTTGTTTGATGTTGCAGATGCTAGCCCGGAGAAACGTGGGATAGAAGCTGGAGACC
GGGAGGATTCAATGGAGAGTACTGAAATTACGCTAGTGGCCAAGCTTGAAAAGCATCAGTGTCGTCGGACTCGTCAATAGTCGTGGATACACCGATGGAT
GTTATGCTTGATGACGTCGGTGATATGTTTCTAGCAGTAAAGCCGTGGATAGGAGCAATTGTACCCCCAAGCAAGGTCCCCCGATTTCTAGAGGAGCCCC
ACTGATCTCAGTCCAGCTAGACTGGGTATTTGGATACAGCGCGCAAGACTGCAAAAACAACGTGCGCTTTGCTTCAACAACGGTCGGTGGCAGAGCTGGA
CGCTCCGAAGAGATTGTATACCCAGCTGCAGCAACATGCGTTGTGCTCAACACAAAATCCATGACTCAGCGTCACCATCTAGCTCATACAGACGATGTGT
TGAGTTTATGTCTGCATCCCCGCCTTCCCTTGGCTGCAAGTGGTGAAATCGGCAAGCAACCTAAGATTATGTGTGGGATTTAGACACAATGGAGACCCAA
TGCATTTTGCAAGGGTTTCACAAGCGCGGTATCTTACAATTAGCCTTCCTGGCGCCTGAATTGCTGGTATCAATCGGTGGAGACGATGATCACAGCATTG
CAATCTACGAGTCATCCAGCAATTGGAACTCTGCAGTATTGAAAATTTCGGTGAGAGGTAACAAAGCGGTCCCGTTCCACCTCACTACAAACCCGAGGAC
ACCTAACGAGTTTGTTACGTGTGGTCAAAAGTACATCGAGTACTGGTCACTTGAAGGAAAAGAACTTGTGTCGAAGAAGGGTTTGCTGGGGAAAAAAGGA
TCTCTGCAACCGTTTCCCGTGGCTCAGTATCTCGAAAATTCTGAACAGGCAGTAGTTGTCGGAACAAGTGATGGCTTTTTGTATCTCTTCCTTGCTCGGC
AATTGACATCCGTCATTAAGGCACACGAAGGAGCAGTCACTGCCTTATTTTACTCATCTGGGCTTTTGGTTTCTGGAGGACGAGATGGTCAAATCGCTCA
ATGGGATGATAAGCTCAAACAAGTAGGCAACGCTTTCCAGATCCAAGATTTGCTTGAATCAACTTCACTGTCTGAGCGCAAGGGAATTCGAAGTTGTTGT
TATTCGCCTGATAGACGAACTATCGTCGTTGGGACACTAGCGTCAGAGATTATGAACTGGATGCTAAGACGGGCCAAAATACTCACTCGGAGGCACTCAC
TAAAGGACACTTTCAAGGCGAACTGTGGGGATTGGATATTCACCCCACAAAGCAGCAGTGTTGTACCATTGGAGATGACCAAACGCTTCGCATTTGGGAC
TTAGCAATGCAGCATGAGTTGGGATTCTTAGAGTTACCGATTCCAGGACGAGCTTGCGCTTACTCTAGCGATGGCAAATTAATCGCAGTCGGTCTTGGCA
CGGAGGAATCTGGCAAGACTGGAAATCCGTCTCGGGCAAAGACCTCATCAGCTAGTTCTAAACGACGGCAGCCTAACGGTGGCTTCGTGGTGTACAGTGC
GATGGATTTAACCTGTGCAAAGGAGCCTTGTTATGAAGCAAAACGTTGGGTGAGCGATATAAAGTTCTCCCCAGACAACAGAACGCTAGCAGTCGCAAGC
CACGATTCCAAAATCTATCTGTACAATGTTCTGAAAGGTTTCTCAAGAACTCACGTTTTCAGTAAACACTCGAGCTATATCACACATTTGGACTTCTCAC
TGGACGGGAACTACTTACAGAGCACCTCAGGCGGATACGAGCTTTTATTCACCGAAGTTAAGTCTGGCAAACACGTCACAAGTGCCACAACATTTCGGGA
CGAATTATGGCACACTATGACCTGCACGCTGGGCTGGTCAGTGCAGGGAATCTGGGAAGCAGAAAGCGACGGCACAGACGTAAATGCCGTTGATCGATCT
AACAACGGAAAGCTGTTGGCAACAGGCGACGATTTCGGAAAGGTGAAGGTCTTCCAGTATCCTTGTGCCTCGGAAAAAGCCTCATTCCTCGAGCTGCGTG
GGCATGCTTCTCACGTCACGAACGTTAGGTGGTCGCCTGGTGACAACTACATAGTGTCTGTAGGTGGAAATGACAGGTGCCTATTTGTCTGGAAACATGA
CCAGCAGCCCACAATGGAAGACGCCAATCACAAGCGCAACACTACCAAAAGTGAAACTACCAGTTTCGGAATCGACTTACTCAGTACGAGAGCTGAAGAC
CCTTTGGAGGTCGTGGCTACGAGCGATGATATTGGAGATGAATTTATGGCGGTACGACCATGGCTCGGGGCCGTTGTGGCGCCTTCAAAGGCTGCTTCGC
TGAAAGTGGACAACACGTCTCCGAACTCAAGGTTGGAATTGGAGCGAGTTCACGGCTATCAAGCTCAAACTGCTTCAAACAATGCTCGATATGATTCCAA
CGGCAAGGTTGTATATCATACTGCCGCGCTTGGTGTTGTGTTCGACAAAGCTGCTCAGCGTCAGGCTTTCTTTAAGAGTCACGACGATGACGTCGTCGCA
TTGTGTCCTCATCCGAATGGTACAACCTTTGCTACGTCACAAATGGGAAAGAAGCCCAAGATATGTCTGGGACTCAGTGAGCGGAGCAGCTGTAGCTCCC
TGTCTGGAAGGATTTCATCAGCGTTTTGTAAATGTTATTTGCTTTTCAAGCGACGGCACAAAACTCGGAAGTGTTGGTGGCGATGATGATCATTCCATTG
CAATTTACGCTTGGCAGAGTGGTGTATTGGTATCACAATCTCGTGGAGAACGCAACAATGTGCGCGGTATGTGCTTCCATGCTGCCACGATGGAGTGGGT
GACATGTGGTGACAAACATATTCGATTCTGGACGGAGCAAGGGAAAAACTTAACTTCGAAGAAGGCAATTTTTGGGACGAAGGCGTATCAAAATGGAAAG
GTTCCGTCCGTCTTTGACTGTGTTGTATCGTTTGGGCAAATGGTAATTGCGGGTGGGTCGAGTGGACATCTACTTGTATTTCAGAGCTCAGTTGATTTGA
CAAAGGCAGTACCGGCACATGACAGCGCTGTATTGGCACTGTATTCAACAGAGAGGGAAATTAATTAGTGGTGGAAAGGACTCCAAGGTCATCGTTTGGG
ATGCCCAGCTAAATAAAGTGGCTACATTCGATATGAAGGAGTACACACTTCAGGGGGCCAAACTTTTGAACTCGGAGATTCGAAGTGTTTCCTCTAACCG
AGTTTCTCCTAGAGTTTTCTTAGTTGGAACTGGCGGGAGCGATCTACTTGAGCTCGATGCTGGCCGCGCTCAACCAACTTTGTCTACAATCACACGCGGA
CATTTCAAAATGGAGGTCTGGGGTCTTGCGTGCCACCCAACCAAACCTGAATACTGCACTGTCGGCGATGACCAAACTATTCGAGTGTGGTGCCTCGCTA
AGAAAATTCAGCTAAGGGTGCAGAGGCTTGAGTGCGTAGCTCGAGCCTGTGCATTAACGGACTCAGCCGACATTGTCGCGATAGGATTCGGTGGGCGCAA
TGCGGTGACTGGTCTATCAAAAGCTGCCCAAGCAAAAACAGGAGGTATTGTTTTACTGAGCTACAGTGACTTGACGAAAAAGGTGTTTGAAGATCGCCCT
TCCAAGCAAGCTATCAGCGAGATGAAGTTCTCGCCGAGTGGTTCCGTTCTTGCCGTTGGGTCGCATGATCATAAGATCTACCTGTATCGCCTTGATCGGA
ATACCACCAAAATCACCAAAGCATCAGCTTTCGACAAGCATCAAAGCTACATAACTCACCTTGACTTCTCAGCGGATGGTCAAGTGCTACAAAGTAATTG
CGGCGCCTACGAACTTCTTTTCAGTAATGCTACCACAGGTAAGCATATCACATCTGCGAGCAGCACGAAGGATACTCAGTGGCATTCGTGGACATGCGTG
CTTGGGTGGCCCGTGCAAGGCATTTGGCCGCCGTGTTCCGATGGCACTGATGTGAACGCAGTCGCTCGCAATTCACGCGAAGACCTACTGGTAACCTCGG
ATGATTTTGGCCTGGTCAAGCTTTATCGGTATCCATGCGTCGCTAAGAATGCGAGCTCCATAGATCATCGCGGGCACTCGTCCCATGTGACCAACGTCCG
GTGGGCTCTTGACGATAGCTATGTGATCAGCATTGGCGGAAATGATCGCTCCGTGATGGAGTGGAGGGTCTTAGGGCAAAATGAACGGGTTCCAGCGGCG
GGATCTGAAAAGATATTGAGCTTTGTTGAGGCAGAGGAAGTCACGGATTCGTCTGCTGAATCGGAAGAGGAATCGTTTGATGAACCTGCGGGGGACGAGT
TTATGGCAGTAAAACCTTGGGTTGGAGCGATTGTTGCACCCACGAACGCTGCCACGCCTAACTCTCGTGAGCCCGAATTGAATGTTGAGCTTGAATGGGT
GTACGGTTATCAATCGGAACTATCACAGCAAAACCTAGCGTACAATGCGCAAGATGAAATTGTCTACCACACTGCTGCGGTGGGAATCATCTACGACTCT
GCAAACCATCTCCAAAAACACCACGTTGGGCATAACGACGACATTATCAGTTTCGCGCTTTGTGACGCCAAACGCAACCTCATAGCAACAGAGAGAGGGG
AAAGAAGCCTTCACTAAGAGTATGGGATGCCCACACAGGTGAATTACGATGCGAGCTGAAGGATGCTCATACTCGCGGCATTTTGTCGCTTGCGTTCAGC
AATGACTCGACAAGGCTTGTCAGCGTAGGGGCAGATGATGACCACTCACTGGCAGTTTGGAGTGATGCCAGTAATGGATCATGGACTTTAGCAAAACTTC
TGGCAACGGGTAAAGGGGATAAAGGCCTGAACCGCTTTGCCTCGTTTGGTTCCAATCTAGATACGATTATCACTGGCGGCGTGAAGCACGTGCTGTTTTG
GTCTGTCCAAGGAAAAACCATTGTCTCCAAGAAGGGCGTAGTTGGCAAGAAAGGGACTTTGCAAACGTTTCCAATGGGCTGCAACTTCGGAGGAGACTTT
GTAACAGGGACGGCAGGTGGTGAGTTGTATGTCTGGAGAGGCAATGATCTCTCAAAGACGGTGAAAGCACATGAAGGGGAAGTCCGAGCCGTGGCCAGTA
CGAATTCAATTGATAACCCGGCTGGAAATTCATCAGTTCTGCTATCAGGCGGAAAAGATGGTCGAATTATCATGTGGAACCCTGCGTACCAGTCGCTAAA
GTGTTTTGATCTGGACGCAATGCACGCCGGGAGCTTTGGCAGGATCATCAATAGCGTGTTTTTAAGCTCTACTGGCACGAAACTTCTCGTCGGTACTTGC
TCCAGTGACATCATCGAGATAGATGTAGTCAGTGGGAGTGTTCTCAATGGAGGCCAGCCGCTATTCTCCGGTCACTTTGCTATGGAGCTCTGGGGGCTTG
CCGTGCATCCCTCTCAGCGAGAATTTATCACCGTTGGTGACGACCGAACGCTGCGGGTGTGGGATATGGAGGCTAAGCGGTTAATTCAGGCACGCGCACT
ACCTGCAAAAGCTCGTGCCTGTGCATACTCGCCTGATTCCGAGCTGCTAGCAGTTGGCTTTGGTGGCGACAATGGTGTACGCCAGAAGAGAGCAGCAGCA
GCCAAACAAGGGCAAACACAATCGAGAGAAGGAGGGTTTGCTGTGTTTCGATCACGTGACCTTGATACAGATAAAGTGGTGGTTGAAGACAAGCCAGCTA
AGGAATGGATCAGTGATATCAAGTTTTCGCCCTGTGGACGTATTTTGGCGCTGGGTTCTCATGACAACGCGCTTTATCTCTACTCTGTGGGCTCCGGGGC
AACAGAGTTCAAGAAACGCAAGCCATTCAGCAAGCACAACAGCTACATTACCACTTTGATTTTTCAGACGACAGCAGCTACATACAGTCGAATTGCGGCG
CATACGAATATTTGTTCTGCGATGCAGCATCGAGTAGCCAAGTGAGTCGAGCTTCATCTCTACGTGATGTGAAGTGGGCAACTTGGACATGCACCTTAGG
CTGGCCTGTTCAAGGTATCTGGCCTGAATGTGCCGACGGCACTGACATCAACGCTGTTTGTGCGTCTTCATCGCGTAACAATTCTCGCGTCGGGGGATGA
CTCCGGCAACGTGAAGTTTTTCCGGTATCCTTGCATCCCAAAAGGGGTACGTTGCCTACTATTACGAAGACTTTGCGTGCACCTAACACCTTGTTTTGTT
ATTGCATCTGCAGTCAAAGTTCATTGCCTGCCGCGGCCACTCTTCGCACGTCGCTAATGTGCGCTTCAGCTTTGACGACAAGTACGTGATCTCAGTCGGC
GGAAACGACAGATCCATTTTCCAGTGGAAGCTGGCCTAGCC