Description :
From Genome Similarity Track
Location :
scaffold_126:53308- 56550
Transcript NameFunction/comments
Pl_109174hypothetical protein PHYSODRAFT_532591
Pl_109175hypothetical protein ALNC14_125150
Pl_109176conserved hypothetical protein

Sequence
3242 bases(100 bases per row)
CAGAGCTGCTGCAAGCAGTGAAGCGCAGTTTTGAAAAGCACGAACGGACCAGTACGTTGTATTCGAACGACTGTTTTTACAAAGGACTGACATTGTCTTG
ATGCTTTGTTAGACCACGGATATATGACGAAAGCAGAACTAAAAGAAGCACTGCGAGAACTTGCATGTGTCTTCACTGACGATCAGGTAAAACCTGCATC
GATATTCTGGACGAATAATTTGTAAGATTTACGTGCTGTTTTCTGGTTTCAACTGTAGATCACCGCTCTGTTTGGTATTCACGATAGACAGTGCACTGGT
AAGTTCCCTGTTATCTGTTGCGATCGCAATAATCTGACAGATTGTGGCTCTCTTGGCTTCAGGCACCGTGCCAATGTCGGAACTTCTCCTTGCATTAAGT
GAAACTATTTAATCAAGAGTTCCTTCTCTTTCGTAAACTCATACGCGTCGCTGCTTTCTTCGGTAAATTCAAAGTCAATTTCGACGTCATTTATTGCAGT
TAGCAATAGTAGCATCACACACACTACCAACGCTATTGATGCGGTATTAGATCTACTCACGACCTGATGAAAGGTCAGATGGTTGATCCTATCCCGCCAG
GTGTTCCCCGAATAATATGTGAACTCGTCGAAGGTCAAACAAACTCTCACCACTACCACACATCTTATCTATCCCCCTCTTTCCCGAATTAGCGGTGGAG
TCAGTGTTTTGGCTGCTCATATTCCAATTGACTTCATCTCTCTGACTCGTACAGGCAAGACAAGTCAAGCAATGCGAGGAGCTTCTCCAGGGACACGAGC
ACCCCCGCCTGGTGATGTAGGCAGCATTCTAAACATGCTTAGAGACCGAGAAATTGAACGAGATGTAGAATTGCGTCAATATCCACAAACAAGTCCTCAC
GACGACGACGACAATGGATCGACGTCGCCTCATTTCGACCGGTATTTGACAGAGGGAGAGAGGCTCAACACTGATTCTATCCAGCAAATGACCAATTTCT
CGGTTGCGCAGTTCAATGCGCTCTGGTTGTCGATCCGTCCGCACGTGATACAACGCTACACTGGTGGCCGAGGTCGGCGCTCGCAGATACGCCCGAAGGA
CGCATTTTTCATGACTGCCACGACGCTGAAGCACGCAGGCACGTGGGAAATGTTGGCAAACATGTTCCAGTTGCACACATCTACGTTTTCTGAAGTGGTG
ACGAAATTTATACGCTTGATTTCGACCGAGGTCTACGACAGAGAAGTTGTGCAGCGCGAACAAGATGTTCGGATGCCGGCACTTCGTACTTCTGGACACG
TGTTCCCTAATTTTGAAAGCGCCCTGTACGCGGTTGACGTGACATTTCAGCAGACGTACCGACCTGGCGGCTCAATTCAAGACAACAAGAGCTATTTTAG
TGAGAACCATCATTTGTACGGCTTCAAAGTAGAAGTCTCGGTCAGTCCCCGAGGCTTTGCAGTTAACTGTACGGATCATGCTCGAGGCAGCACGGCACAC
ATTACAATGTTTAAAAACAACATTGCTTTTCATCAGCGCATGATGAAGAAACTCGACAGTGACAAAGATTTTTCCGATGGTGGACTACTGCTCGACGAGT
ATCCTGACCAGTGGGCGATACTTGCTGATAAGGAGTATCAAGGCCTTTCCAGACAATTGCGGTGCATTCATCCCAAGAAGGGAGCGAACCTGACTCCATT
TGACAAAGCCAACAATAATCGAATTTCAAACGATCGAGTGATAGTTGACAATTTTTTTGGTCGAGTGTCCATGCTGTGGCGTGTGTGCTCTGAGAAGTAC
ACGTGGGGGGAAGAGCTGTATGACGACATTTTTCGGCTTTGTGTTGGTTTGACAAATCATCACATTTCTTATCAGCCTTTGTGTGAAGAGACTGATGCAA
AGTACTACAGGCAGGTTCAGCATAGGCTTCTGAGCATCGGGGAAGAGATCAAGAGAAAACGCCGTATTGCTCAAGAAAAATACAGAATGAAGAAGAAAAG
ACGTACGAATACGTCACTGAATGACATGGGCGGAGAATCAGACGACAACTGATAGTGCCTACTACATTGACTGCTTGGCTGCTTGAACAAGCCGATTTCC
AATCACTACCGGTATGCGTCGAAGAATTTGCATCAGTACGATGCTCACAAGTCCGCTGGAAGTGCTCACTTCCAGACTTGGTTCAAAGTTAAGCTCGAGG
ATTTCGTGCAGCGTAACTCAATAGCCGCGCCACGTTGTTCAGTAAATTTCATTCTAGCGAGCAGCGACAATAAAGTCGGTTTGGCTTTCCACTTCACCAC
ACGGTTGTTTATACAGATAGTCACCGGCTCACCGAGCATCACAAAATGCAACGGAGCTGACAGTAGTTGCGATCAGGCAACCGTTCTGGAATCGACTTGA
CCGGCGTGGTGCAACTGTTGTCAAGAAAATCCAAGCAGAAGCTGAACCTGTCACCTCAATTTGACACGCAAGGAAACATCGGGATACATGCTGCTGAATT
AAAATGAGTACGTGCTGTACTATCCTACAATAGTTTGTTGATTTCAAGGTGTTCTACGCCTTGGAGTAGTGGTATCGTGGCTGGTCCATCGATGGGGTGA
GCGGGTCATCGACCAGTTCGGTGTCGTGACGGCCGAGCTGTTGGCGACGGCGTATACAGCACGCGAAAATAATGATCATGAGTGCACCGAAGCACACGAG
CACACTACCGATGCCCATATACAGCGAGTAATCCTCCACGAGGTCTAAGAATTCGGTGCGGCACTGTGTATAAGGCGCGGTACCAACGGTGATGTTCGAC
AACGATCCAGTAGCCAGGAACTCTCCGCAATACACCAACGTCTCGTTCGTCCGGGGACATTTATCATTTGCCCAGTCAAAAACCTTCGTGTAGTTCTCAA
ACTCGCGCGCTGTGTCGCATCCGTTGCAAAGACTCTCAAGCTGGCTGTAGTCGCTAAGATAGTCGTCGCACAAAGTGTTCACGCCGCCTGTCACGTTCTC
GAACAGTGCCACAGTCGCCGTATTGAGGTTAGGAGCAAACATGGTCAGCGCTTCTGCAACTGATGCCTCGTTGCAGATATATTCTCCTTGTGCATAGCAA
TACACTTGATCAAAGTCGATTTTCACGGTCTCCTCGGCGCTCTCAGCTGGGTACAGCTTGTCACTCCAGTCATCCGCTTTGGCCATCAAAACGAAGGCAG
CGATCGCCACCACCGCGAATAAAATCAAGAATAGCAGCACAA