Description :
From Genome Similarity Track
Location :
Scaffold_176:53307- 56288
Transcript NameFunction/comments
Phypl_g4751hypothetical protein

Sequence
2981 bases(100 bases per row)
TTGTGTTAGTTGAGGAGTATACCTTGAGAATGTGGAAGTGTTTATTGTGTTATCTATCTCCTCGCTTACCTACAATCTCGCTGTAGGCATCTTGACGTCC
ATCCGTAGTAGGTCGCGCAGATCCCAAGAGTGCACGGCCGAACCGGTTCGCAGACTGCGGTTCAGCCCTACTTCTTACactcctcctcggccgtcgCACT
CTTAGTGAGCGCGTTCTACTTCAGGCTGAAAACCTCACGCAGCTCTGCCATCcttggtgctggaagcgccTTCGTCAGGAGGTCGGCCATCATCAGGCGC
GACTCCACGTACTCGGGCTTGACGACCCCCTTCTTCGCGAAGTCGCAGACGAACTTCACGCGGATGTCAACGTGCTTCGCACTGGACACGCTATCCTCGG
ActccagctgctcgatcgCGGCCTGATTGTCCATCAGCATCGGCATCGGCTCCACCGCTTGGAAACCGAGCTCACGTACAACCTCACAcagacccagcag
ctcacgccCGACATGAGAGGCCGACGTGAACTCGGCCTCCATCGTGGAGAGCGATACGCCAGTCTGCTTTTTGCAGATCCACTGCACGACGGCGCCATCC
AGCGTGATGACCCCGCCAGTCACGGACTTCCTGTCGCCCTTGTCGGCGGCGAAATCTGcgtcgctccagctcgcaaTGGCAACCTGGTTACCTGCGCTCT
TCGCGACCTGCATACCGATCTTGAGGCACTTCGTGTCCTTTAAGTACCTGGCAATCCTCTTCGCCGACTTCCAGTCGCTCAGAGTCGGCAGGTAGGTCCT
CCGTGTGGCCTTGTGCACAGCAAAGCTGATGTCGGGTCTTGTGCAGCGCGCGACCCAGAGCAGACTCCCCACCAGTGACTGGAAGTCGCGGATCGTTGGC
TCGCCCCGAGCGCCCTTCTGCACCAGCAACGTTGGCTGGTTAACCACCTCGTTGCTCTCGATTCTGATGGGCCCGCGCACTCCATTTGCGTCCGCAAGGC
CATgctgttcgagcagctcctcgatggcgGCCTGCTAGCCCAGCCTGTacccgtcgctgccgtccagctccacgcgcatGACGAGGAACTTCCTCACCTC
GCCGAGGTCCTTGATCGACAAGGTGCTCATCGTGGTGAAGAAGTCCTCGATCAGGTTGGGGTTGGACGCAGTGACCAGGAGATCATCCACGTACACACCC
ACGAGGGTCATCTCGCTACCCTGGCGCTTGTAGTACAGGCACATGTCCGTCACGCAACGCGTGAACCCAGCCTCTACTAGcttggcgtgcagcagcttgt
catGGAAGGTATGGACCTTGGACACCGTGAGGCTGGACGAAGCGGAGGGAGGGTAGCACTCTGGGCGAGACCGAAGCGGAAGCAGGAAACCACTTGAGGG
GTAGAATGAAGATTCGAAAGTGATTGATTGATCGGAGTTACTCTAGCTAGCCTACCGCATAGNTTCTACTCGTCTAATCACCGGTGGCGTAATCAACTTA
CCGTAATCACCGTAATCAACGTGGATTCGGATTGGACCGGTTCGGgttaaccggttcacggttaatAACCAATACCAAACCGGTAACCCTCAATAGCTTG
CTCCACAACCTCCCAAACCATACAACGACTTCTTCAGGCGtagcgccagcttcgacttgGTGTCCACGCCGAGCTTGCGTAGCATCCCCACGAGAATCAC
CATTCCCTGTGAGATGCACAGGTAGATCTCGAGGTCATTCTCCTTGTCAGCTTTGACGTACGCATTTGGGATGTCTCCGTGCCTTGCCGGCACACCCCAG
CGGCGTGCAAACACCAGGACCACCTTTACGATACTAAGCTCCATCACTGCCGCGAAGGTGAGCGTGTAGTCGATGCCGAACATCTGTTCGTTACCACACG
CCACTAGCCTGGCCTTGAACCTCTCGATAGCCCCATCAGCGTCCGTCTTGGTCTTAAAGACCCACTTGGTGTGCAGCACGTGACTGCCGCACGGCGGCAC
CTCGACCACCCACACACCGttggcctcgagcgcctcgagtTCCTCCGCCATTGCGATGACCCACTTGTCCTTGAGCCTGCTCCGCATGGCCTGTCCGTAG
TTCTTCGggtccacctcgcgcacgcTATTCACCACGTCGCgggcttgtccagcaccactgccTTCGGTTTCCTggcgcgccgctgcctcTGCAGTCTTGC
GCACCACCGATCGCGTGCGGTGCTCCTCTCGCGTCCAGTTGCTTCTCCGACCGCGGCTCTTCCGTTTCGTCTTCGAAGCCGGTCCTGAGCCGCGTCTCCC
TGAAGGGCCCGTGTTCTCCGCCGTATCGTTCGTATCGGCGAGGTGAACACGGCGCAACTGCGCGttctgctcgtccgtgagAGTCTCCACGTTTCTTACG
TGCTGCGTAACTACCACTATCTTGTCCTTCGGGATATACACTCGGTACCccttcagctcgtcgctcttccCGACTATCAAGCCTGGTTTGCCGCACTCGC
CCAGCAACTTATTCTTGGAATCTCTGTGCACCGTGCACGGAGACCCAAAGACCACGATGTCGCTCAGGTCGGGCGTGCTCTTCGTGAGCATCCGCAGCGG
CGACTTCCTGCCCGAGTTTGCCTTGCTCGGGCTCCGGTTCAAGATGTACGCAGCGTACTTCGCCGCATTGCCCCAGAAACTCAGCGGCAACCCACAGGCG
AATACCATGCTTCGCACCATGTCCATGGCGGTGCGGTGCATCCGCTCGGCCTTGCCGTTGCTAGCTTGGTTGCGTGGCTCGCCGACCTGCCGCCCGATCC
CTGCCTCCTTGCAGAACAAATCCAGCGTCTGGTACTCCCCGCCGCCGTTCGTCCTCAGCACGTGAATGCGGCAGTTGAACTGCCGTTCAAAGAAGGCCAT
GAAGTGCTTGAACTTCTGCGCGGCGACGTCTTTGGTCTTTGCCAAGAATACCCTGCAATAGTTAGTCCGGTGGTCTATAAA