Description :
From Genome Similarity Track
Location :
scaffold_116:53303- 54417
Transcript NameFunction/comments
Pl_109419hypothetical protein PHYSODRAFT_553002

Sequence
1114 bases(100 bases per row)
CGCCACCACTTCCGCTACCGCTAGATGCACCACCACTGGAACGAGGGCGGAAGGCGTCGTGGTTACGTGTGAAATCTGGGTCATTCAGCTCCTGCTCGCG
GTTGCGCCACAATACTTTACTTTCTTTCCAGTTTGCTGCATTAGGAGCACTCGGATGGGACGATCGCGAGTATTCGTTTCTATCATTACCACTTGGTCGT
TCGTTGGGTTGGGGTCCGCTCGCAATTCCACCAGAAGAGATAGCTCCACGTCCACGACCAAAACCTCTGCTGCCATCTGGTCCAGCTGCTTGCCGACTCC
CAAGCCGAGCACTGCTATTTCCCATACTTGCACCACTTATACCTTCATGTGCCGACGAGGTAGTCGACGATGGCGACGACGACGACACTGATTCTGCTAT
CGTGCTACCGTTATCTTCTCCAAAAATTCTTGCTCGTGCCTCAGCATATGCACGTTCACGGTCCTGTAAAGTTGGTGTAGCTTTATCTGCTCCATTACCT
CGTCCACCATTAGTACCTGGTCGTGGTGCACTACGTTTCCGCATCATAATTCTCGGTGCAGACGCTGGTGTGACTATCTGCGTCTGTCGATCGGCCGACA
AGTCAATAAGCAGCACACGAGGTACTGCCGACTGCGCAGTTTTAAACAACGTCACTACCCGTGCTGAGCTGTTTTCGTACGGATTATAATCCGCCGTTTG
GTGCTCCAAGCCACAGCGCTGTGCCAATCGATGAACAATAAGTCGATGGTACGACGACAACGGAGGGAAATTGAGATGTGGCTCTCTCGGGTTCTTAAGG
AATCGTACAATTTGGTCTTCAAACTTGAGCAGTGTCATCCTCTCACGTACATTCTCCAGACCTGCAACTAACACAGGGTCAAGTGGGCCATGCGCACTGG
CAGTTGCTGTTCCAACTGGAGCGCTATTGAACTGCTGCTGTGGATAATTTCCACCGTCATCAGAAGCGGGTGGTGGCTGCAAGATGCGAAGACTCTGGAT
AGCGCGTGTAGCGTCTTCCACGTCGTCTGTTGGAGGTCTGGCAGCAATAGAAATTGATCCTGGGACTCTGGAACTTGCGCTATCAGCCGCAGTCTCCCAC
TCGTCGTGGTCGCC