Description :
From Genome Similarity Track
Location :
Scaffold_141:53301- 58158
Sequence
4857 bases(100 bases per row)
ACGGAGCCGTCTTGCTCCAATTGATGTTTAGGATTGATGTTTAGGACGAGGCTGACTTCTGAGGAACAGCAATTTCAACAGCGCTCTGGAAGCACACATA
AATTGGGGCCAAAGGCAGTCGTTCTTGATTATTGTAGGCAAGCCTCGCCGCGTCTCGAGAAGGGAGGTGAGGCGAGGCAGCCTGTTAAGTGAGGTGGGTT
TTAAACTCGGGCCAGCGCCGGCTTGTGAGCTGAGCGCGCTTGAGCCTTGACCTTGGAGAGCTTGGGTGTATCCGGCGAGGCAAGTTGGCGACTGCGCCGA
CTCTCCGAACGACTGCCGTGCTCGGCTCGAGGACGGTTGCTGGCGGAGGCTGGGCTGAGCTGCTTTGCATGTTTTATTCTATTAGACACTTACTCACCTG
TAAATTTACCTCATTTTCAAACCTTCTCCGTGAACACGTTTGGGGCAAAAGACAACGTCCTTAGATCACCGAAGGCATGCCTCGCAGCGGGTTCGCAGTG
AATCCGTGCGAGGTAGCCCCCGATGAAATGGCGAGGTGGACTTGGATGGCCGCCTTGATGCCCCATTGGTGCTTGGCTGGGTTACTTCCGGGAAGTAGGG
AACTAAAATCAACTTACCGGTATTATTGTGTGTTCTGTTCGAAATTTCCGCGGGCGGTTTGTTGAACCGCCCAAGCCAAATCTCCGGCCAATCTCCGTGG
CCACTAGGATTGGGTATAGGAACCCGTTTAAGTACGAATTGGTCTTGACATGCGGGCACTTGGACCATATGGTTTAGGCCCGGAGATTGAGCAAATGACT
TGAGTTTTGTATTCGGCGATTGGAGCGGGGTCTCCAAACCGCCGCGATTTGGAAAATTTGGCCGGAATTCACAATAATAAATGGAGAACATTAACTCGTG
GCAACCGAATCGACACCACACACACACACACTATCAACAGCATGCACCGCAACTTTCTCCACCCTCGAAGGCCGCTTGCTTGCCCGCAGGCTAGCAGCAT
CTTGCCACCAGGAATATTGGACTGCTTATGCGGCTGGAAGCGTGGGTCTGGCGGTGTTTATTGCCGGCCTCCCGCCCTTGATGTGTGCTGGTGAGCTCGT
GCGCTTCTGTGCTCGTTTTTCGGCCAGCTCACGAGCTGCAATAGCTTTCAGCTCTGCAGCACGTTGAAGCGCACGCTCAGCCACATCCTGCTGAGCTTGC
AAACGAGCAATCTTTAGTGACGTCGACTCTCCAGCAGATTCACTCTTGGCAGACCCAACCATAGTGATATCCGTACCATCAACGCTAACCGCCACTTCCA
GTCTCCGCATTTGCCACGATGACTTCACGCGCTTGCGCTTCCGCAGCTTTCTTGGCGACAACGATGGTTTCTCTCAGTCGCTGCTCCAGGCGTTCTTCCA
CCAGATGTTGCAGCTCCATTAGCTGCCTTTGCCACTGTCTGCGATTCTCCTCCAACAAGCTCTTCACGAGCCCCAACACGTGCGATTCAGCGCGACGCAC
GACTCTCTCCTCCAAAATCGCCATCGCCTGGCCCAGACGAATATCAACCTCCGATACTGCAACAGCACGCGCTCTCTCCTCCGCCAGCTCGACACCATGA
ACAGTCCGTCGTTCCAATAGCTCAACGTCAGCTCGCAACGCGTCACGCTCTGAGTGTGCCGCTTGCTACAGCTGCAGAAACTCGTCGTTGAGGTTGGCCA
TCAACGTCTGCACTGCTTGTTCCGCCCTCAAGGCTGCGCTCTTGCACGTCGACAAGAGCGGCGCTAACCCGCTCCTCCATCGCTCTACGAGCTGCATTTT
GTTCCGCTAATTGAGACTGCCATCTCTCGCGCTTGACTGAGGCTGGCGTCCTGCAGCATCGTCAGCACCCTCTGGATGCGGTCGTCCACGCGACGCTCCA
GTGCCATGGGGTCTCCGTAAGCTTGGTTAATAGCGCACACGAGCGCTTGAGTGCGCGCCACCGCCTCGAGACGCGCCTGGGCCACGCGCTCCTCCACGAA
GACTTGTGACGCGCATCCTGCTCCGCCTGGCGGTCGGTCAACACGGCGTGCACTTCTGCCAGGTGGTTCGCCTGCGCTGACACGTGCGCGAGCGCCCTGC
CGAGACGCTGGTTGTCTATCGAGTAGTGATCGGGCAGCTCGATGATCGCCGAGGGGTCCAAGTGATGGTACTCGGCCAATTGGGATCGGAATTGGAAAAA
AATGTTAACTGAAATGTTACGGTACTTCTGAATCGTACAAAATGATTTCCAGATCGACACTGCTTCCCTGTTGATGTCCAACAGGCGAACAGGGATCAGG
GGCAGAACAACGGGTATTAATTATTTTTCGAGTTACTGCTGTCAGTTTCGAGGCGAGCCTGAACCGTTCAGGTGTCACCAGCATTCGCACTGGTGGAAAC
CAATTCCGGGTACGGAATGAGAATTGCGTACTGCTCAATTTTCAGCGGTGCCTTCTTTGTGAACGTTTTGAAGTAGAATGGTGGAAGCAGAAAATAGAGC
TTGCTACCGTGCGGACCCAGCATCGCCAGGTCTTCTTTCGCGCCGCCCCGGATTGAATGTGTCTTTCCAACGGTCATTTGAAATCCACCCACATCTGGCA
TCCACGCGTCGATGGCAGGATAATTCGATGCGTCTGGCACATATAGCTGATTGCCCCGTTGATCACCTCGCACACGATCCACTATTTCCCGCGTCGATGC
TGGAATCGTGATTGTCCGTGAATATCCAGGATTCGACGTATATCGCCTACGCTTGCCTTTCTTTCTTTTGCCCGAGCTTGCTGGTTGTAGCTGATTCCCA
GAATACAGTTCTCGATACTCAAATCGGCCGTCTTTTTCAAGTAGCTCCAATGCTAAGTCCTCGAAGACGTAGCCACATAGAGCTTGTGTCTTCGGGTTGC
ATTCTGTCGCCATAAGCAGCTTCCTCATTTGCTCAAGGCATTCCAAACGCTTGGTAGAAGCAATCACTCTCAGCCAAATCGGAAGCATAGACAACATTGC
AGGTTATGTAAGGTTCTTGGCTGCGGATGTGGACGAGTGTCTGCACAGCTTGAGTTTTCGAAGTCACCTCAGCATCGCTCGAGGACACAAGCTTGATGCA
ATCATCAAGCGAGGAGCTTTTGCACGCTTTCCGCAAGACAACTTGTGGATCCTTCACGCGATTTTGAAATACTAAACGAGGAACACCACCCAAGCCTTTG
AACAGCATCTCCCACACATCTGCAGCTCGCGGGTACAAGGGAGCAATCGCCGATAGTTCTTGGACTTCCCACACTGGCATATAAAACTGGTCTGGAGCAG
GGACTAGCTTCTTGAACTCATTGATGCACTCTCGGCGTGGCATACTTGCAAGAAGCGTAGAGCAACGGCGGACAGGAAATCCCCTGTAAGTAGTCGGATC
GACTGAATCCACCAAACACCACAACTCCGGTGACCAGAAACGCCGGTTTCCTGACGGGGGCAACTCTGTGCATTCCAACATCGTACTGCCGTCGAAGTAG
ACTGGCGGCTCTTCGGTCAAAAACAACACGCGCTTTCCTTCCTTGACCAATCTCCACATCACATAGTAGAGGAACACCGATTTCCCGACCCTAGGCGTAC
CGGTGACGACCGCATACTTCTTCTCCATGCCGGGCTCATCCTTTGACAGCGCCTGATCAGCGATCGACTTGTATGAAGAACGAATGTAAATCCTTTGCTG
ACCTGTCACCATCAAATCCGACTCGAAGTTAAGCCATCCATCCACCTCGTCTACCGTCACAAGTTCCGAGAAGAACGGGTCTCGAACGACCTTGAAAATG
CCATCATCCATGGGTACTTCAACGCTGGCATCAAGCCTAGGTGCCGTGAATGTCTCCTGCCTCCGCCACAAAATTTTCTCCGAAGTAGCCCGAAAGTTTG
AATGTCGATTTCACCCGCTCGTAGCTTATTGGGTGCCCGTCCTCATCGAGCGGCACATCATCAACATCATCCTCACTCAGCCAGCCCTGGCCCACCTTGG
CCAAGTAGAGGTGCAGCTTGTCCACTCGTGAATACTTCAGCATCTCTACGATGATCAGCTTAAGTTCGCCGACCGTGCGCAACTCGTCACTGACGACGGG
GAACGTTCCTCTTTTCCCCACAGGCTCCATCATCGCGCAACTCAGGAGCACCATCTTTCCTTGTGGGGTCGAGTCGAAATCTGGAATAAGAGAATAAGAG
AGAGGAGAGAATAGTACTTAACCGGGAACGCTGCATTTCAAAAATTTCGTGGCTTAAAAAATGTGGATGTTTTTGGACCCGAATAGACGAGAACCATTGA
AAAACACCATGCCCATCACCGGTCTACTAATAAGGGCATTCTGGGCCCAGACCCCCGCAAAAGAAAAACTAACTCCGAGTTGAGGCAACCGGCCGTTCGC
TGGAATGCTCGTCGCTGGGCCCGCCTCCGCAAATACCGCGCGGCCCTGCTTCGCGGGCACCCCGCGTGGGTTTGCTTTGGCTACGCTCCTCGCACTACCG
CCGTCTAATGATGTGCACCTAACCCTTAGGCTCGGTGTTTTTCAGGCTTTTGTGGTGATTTTTATATTTTCTCCGAATAGACACAATATTTGACATTTTA
AATTTTTACAGATCTGCTGGTACCAATTTGGAAGAGGTGGCGCAAAAAACTTGGGCGCGTGGTATCGTCGCGATGGAGGTGGTGGGTGGGCTGGCACTTA
TATCACTATGGTTGGGTCAGTCAAGACTGAGTCTGCTGGGGAGTCGACGTCGCTTAGGATCGCTCGTTTACAAGCTCAGCAGGATGTGGTCGAGCGTGCG
CTTCAACGTGCTGCAGAGCTGAAGACAATCGCAGCTCGTAAGTTGGCCGATAGACGA