Description :
From Genome Similarity Track
Location :
Scaffold_2494:533- 2934
Sequence
2401 bases(100 bases per row)
TATTCGGGTGAACTCCATAGAGGGCGTTATCGGTTAGGCGTTGGTAGATCTGTGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTTGAACAGGCC
AAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTA
TCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCA
CCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATTG
TTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCTGACATCGATGTCACATTTCACTCCGCGGGCAGCGGGCGGT
AACGCATTGCCTTTACCGATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGA
TATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAATCCCCGCCTTCACGGTAG
CAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTA
CCCTGGTATCAGGGAAACCACCTTTTGGGTCGACTTGATCCTCTGGAGGGTTTACCCACGATGGTTCCTGTTTAGCTAATGCGGCCACTCTCGCCAAGGA
TCCAGACACTTTGTCCCATGCAAAGTTGGGATCCACTCCGGGGTCAGCGGGATCTGGCGGTCCGGCTTCAGCCCTCTGCGATCCCTCGTCCACCGATCCT
GCGTTATCTAGGGGACGACTCTGGGGATCATCCCCCGTCGTGGATCCAACCTCCATCGCTTGGATCTCGATTCGACGATTTCTCTGCAGGATCTTTCGCG
GAGTTGGATATGGAGGCCGATCCACCAAGGGCCAGTTGGACCCGCCGGGAGCTCCATCTCTCCGAGAGATTCAATCTCGGTAGTCGCCTCGTACGCCAGA
TTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGT
CCAGTAATAGTCTCTTATCGCTGATGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCCGGATTACGGTAGGCACCCATTTCTCGCCCCGAGTGAC
CCACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTTTCCGCCCTTATGATCCTCATC
TTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGACCCAACCTCACTCCGGCTGGTA
CCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAATCCAAATATCAAACCAGTACACCAAACAACCTGCCAACGTGATCTTGATCCG
CGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTA
TCCAGTATAGACACCTCGGCATCACTATCTAGGAGTAGGATTTCTTTTTGTTGATCTTGCTTCCTACCTTGGCTTGTCGGAACCACTTTCCAAGGGCATG
GTACTTCCAGTATCCACGGGAACCCCTGTTAGCAGATCCATGGATCCAACATCCTCCGATCCACGGGATCCAGTGACCTGGCAGACCTTAGGTGGATCTG
CAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGCTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGAC
TTCGGATCTGGCAAATCCATCCACTTGGCGCAAAGTAGAAATCTTGGCAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTG
CTATCTGAATCTAGCGATGTCTTGCTCACAAATGCATAAATGCAATACCTAGAACGTTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAA
CATCTTCTCGGCCACTTCTGCCAACATCCCTCTGTGCTTGGCTGGATCAAATCATTGGCCGCATCATGGTTGTAGAATTCTTCCATCGGACACTTGCCGA
C