Description :
From Genome Similarity Track
Location :
Scaffold_11:532963- 534989
Sequence
2026 bases(100 bases per row)
GGGAATTATAAATACCTAATCAGATGGGTTGGAAATGAGCCTGACTCCTGGGAACCGCAAGATAACCTACGCCTCATTAATAAGAACAAGATGAGTACCT
TAGAAATGAATTACTTCACGACGGTGGGTAAGGATTTTCCTACAAAGTAATTGACTTTAAGTCAGGCGTTATAACAGGCCGGGGCTTCGGTAGCTGTTCA
AAATTATACAGGCTAATGGCGGCCTTTGGCCTTCTATTAGATTTTTTTTTTCACTTATCTTAAATGGTTTAGAGTACTCGCGAGTATCTAAAATATAGTC
GCATGTCGGATCATAATCAACGTATACAATATCCATGATTAAATCGCTATACCAATATAGACAAAAGTCGTAATTAGAACGAAGTGGTGCAATCGGAGAT
TGCCTGATCACCTTCGGTGTATCGTCGAAAAGGCGGAGACTTGTCTCTTCAGTCCCCTGAATGACTTGCCAAGCGACTACAAAGTCTGGTAAACAATGCT
CGCGAGATTCCTTAGTTTCTGGATACTGCTGGGAGCATGAGAAGGACTACAAGATTCAAATGTTCACAAAAGAGCTAAGGAAGATGCATCAACGCGTTCG
AACGTTCAGCGAGAAACTCAACGTGTACCATTCATTGATAGTTGATATCGATAGACTCGATTATATCAAATATCGACTTCATCAACTCGACGATAATAGA
CCTTATCGATTCATCTGCAATGATGCTAGATTTGAAAAGGAACTCGAAGAGATTTTCGATCTACCTTTCGATGAGTGTCAGCAATCGTATATCTCTCTAC
AGGAGCGCAGAAACAAAACTGTACATAAGTATACGATGCGATATTGGAGAGAAGGAGAAGACGGGCCTGCAGTACTTGATTATAAACCACGATTTAGGAA
TTAATTTCGAGATTGGTATATAGTATTATCATAAATGTTTCCAAACTTCACTTCATTAGCCCAACGTGAGCAAAAACGTCTCGATCTACTCGATCGCGTC
AAGCATCGTGTTAGGCAAGAAGAACTGAAGCGAGAAATGTACGCAGATGCTCAATGGGCATCAGATGTCAATAACACCATCTCAGTCTCCAAACGAGCCA
CTCAAGACTCGGGCGATCAGACTGAAGATGGTTTTTTAAAAAAGCAACCAGTAGCTAAATCAAGTACTGGTGAGACTTCTACAGACTCCCAAGAAGTCCC
TGAAGTTAATACTGAGATTCCCGATGAAAGACCACAGGTGGAGTCGCAGTCGCAGACTGACGGCTCCGCCTCACGTCTGAGCGACCGCTCAACACCAAAA
CCAAACCTTGAGGAGGAAGAACTACATAAGTCTAGTAAAACTGAAGAATTCATTGCAAAGCGATGGATACAAAACCTCTATAAGTCTAATCCAAACTGGA
TAGCTCTCAGGTTCAATCCAATCAAAACGAATACAACTCGCGATATGAAACGATATATTGGTAAAAATGGAGAACTTTATAGAGTTTCAACGGGCAAGCC
TTCTAAATCTAAATATATCGACTGGGTACTAACCGCTGAGGATCTGATGAATATCCGATCAGATGGTGAGTCGAATAGCATTGACGAAGTCAGCTTGATG
CGGATGGAGGATGCCAATATTCCATATCAGAATATAACCGGCAATAAGAGACGCGATGAATTTCCTAGTCAAAGAATGGGGAAGGTTCACATCCGTCCAA
CTTGGTTCCATGATAGTTCGTCATCGACTACAGCCGATGAGAAACAAGCTAAATCTAAGATCCTATTCATGCTGAAGGCTTACAAGAAGAAATTGATTGG
CTCCAATATTGTCATTAGACCAGTTTTAAAAGATGGAGAAGTACTAAACAAATATGAACTAATCACCGACTCGAAGGGCGATCTCAACGTTAGAAACCAA
GAAACGAAGAGGAATAAGCAATCTCGACTGTCTGAGATCTCCTGGCAATCAACTCTAGCTTTGTTTAGCGAGACGGTCAAATCGAGGGGATTGACCTTTG
AATTTGAACCATCACCAGACACTGTT