Description :
From Genome Similarity Track
Location :
scaffold_12:532934- 535078
Transcript NameFunction/comments
Plaha_PHALS_13281hect e3 ubiquitin

Sequence
2144 bases(100 bases per row)
ACAAATATCAAAATTATTATTGCAGCAATTGAAGCGGATTACATTCGTTTTCGTCTGTGAGGATGTGAATACCCGGATAATGTTATACAGGTGAATCGAA
AGTATCATGCGGTTGTAAATCCTGTAAGATCGGTATCCAGCGTGGCATACAACATAGTtttcaactccttcttgctatTGTATAAAGGCAAATCCAGACG
ATTGAAACACGCGTGGCTCGAAATGTACTGCGTCGTTTTGTAAGGTATTCCCTTTAAGTTAAATGGGCAAAGACGGCCATCGTAACTTGTGAGGCCACGA
AAACCCGACAGAGGGACACAAGCAGATCCAGTTGCGAAGAGCAGAAGACGACGGCGATATTCATTTGGCATTTGACGAACAATCTCCCAGAACCATCGAG
TTACGTCAGCTTCCTCTAGATTCGGTGACATCACAGTATGTCCCTTCCAATCCGCAACATCAATTTCAGGAGACCCACAAAGCAAATAATCGAACTCTTC
AGGGTCAAATGTCAAGAGCATCTCGCGAGGAATAACTTCATATAGACCTTTTAAAAAAGCGTACATTTGATCTGCAACACTTTCAAAGAGGACATATCGG
AAGCGACGATCCAAATACTCGCTCTTGTTAGCGTCAGTAACGGCAATGTTTCTTCCATGCGGGATCAAATCCACCACAACCTTTTCAGACTCATTCACCT
GTTCAGTAAGACTAAAGTCAAGTTCTAGATCGTCCACATTGTCATTATCCATTAGCCAGCGCAAACTACGATACGTCTCTGGGTCAAGAAATTCCATGTC
AGCGAAAGTCACTGGTACACCTAAGATCACCTTTAGCAATGGCAAGGCAAGATGAAAGCCCCAGATTCCACCTTCTAACAGTGCGCGGCCAATTAAACGC
CCTGTGGCAAAGTAATAAGTAAGATGATCATCACCAACTTCTACACGAGATTGTGGATTCAAAAAGTAACTCTGATCCGCCTTATTGGCGCACGTAAAGA
GCCGCAACGTTGGGGATGCAAGCAGTTCATTCACTAGCATAAACCATTCACGGTGCACACCTCCAGCATCCACACCACTTTCATCTAGAAAATTGATACG
CATAAATGAACGTAGATTCTTAGGTTGAATACATTGCATGTGATCCATGGACTCTTCAAGCATGTAATTACGGTGAACTGACAGCTTGAGAAACTCCACT
TCTGCGGGTACTATCAGCGATGCCGTAGTGACGACAAAGTGAGCATATTTAGTTGGAAAGTCACTCGAAGCCAAAGAAATGGCCTCTTTGCGTCGCTCTG
GACCAGCATCAGACAACATTGATTTGCCCGTCGGAAACTCCGTCGGGTcggaagctgacgcttctacCATCTCAACCTTTACGTCTGTTGGTAGTACTGT
TACATATGAAGCGTCTTCTTTACTATTCGATGGATGTTCCACAGCAAGTACAGGCTCCGTCTCTGAAGTCATCACGTCATGAACTTCATTCTCTTCATGC
TCTTCGTTTGATATCTTCTCGTCTTCTAGCTTCAATTCTTCTGAAATGATAAGTCGCACGGTATACCCAGGCATCAACGAGTCGATTTCACTACTTACAG
GCATATTACCTCCCCCACTGCGATACCAAAAGAAATTACCCTCAACGTCAAGTTTCCTACTCCACTCACGACGATTCCTCGCGCGTCGTTGCTGTCGACT
TAAAGACGATAATTTTCGAGGTCGTGGAGACAAGAGATGTGTTGATTGACGAGACTTTACCATGTAGACAGAGCGTTCTCGGCTTGAAATGGTTTCACCA
GACTGAGAATGGTCCTGCTGCTCACCATCTTCATCACTTTCATCATCGGCTGTCACCATCGAGAGCGATGGCAATTTATCACCACATAGTACACAGTGTT
CAAAACGTCGAAAGTTTTCAAATTCACAACTGGCACAGACACTATAACCAGCCTCAGCTTCTCTTGTCGCGGCATCAATTCGATGATCAACGGATTCGCC
TGATAGTAACGGGATCTCCATATCTAGAAGATGTCGATTCCGTCGACATGCCATGAGCCATACAACAAAAAAGATGACGCAAAGCAGTAGCATTCCTACT
CCCTGGTACAGCATCGATGCTTCCGTCGAACGGTCATTATCCAT