Description :
From Genome Similarity Track
Location :
Scaffold_5:5329320- 5331627
Transcript NameFunction/comments
Physo_263134midasin-like protein

Sequence
2307 bases(100 bases per row)
CAGCTTCTGTGTCTCAAGGGCTTCTGATGATTTCGCCACAACCGGAGACACACCGTACACACGCTTGGAAGGTCGCGCAAACGCCACAATAGCAGCGTCG
CCACCCGCGTCCTCGCTAGCGTTCACAGCACGGTGAGGAATCGCCGGCACACCAAGCGACTTCGTCAACCCAGCACAATCAGCGAAAGAGTTTTGAATGG
CATCACAAAGTTCGAAAATGCGCTGGAATAGCTGGCGAACATCCAGAACCACCGACACATTCTCCGACGATTGCTGCAAAATCTGCACCACTGAGATCTC
AAGCTCACGCAGGGTCTGTCGCAATGAAACGACGGATGTTTGCTGGAATGCCTGCCACTCACTCGCCGCTCGGGGGTCGATCGCAGCCTCGGCGTCGCTG
TTAGACGAAAGGTAGTTCGTCTTGAACTGCTTCAACAACTTAAGCGTGGCTAGTCCATCAACAAGCTTTTCGTGACTCAGCGACGTGGCGTGAAGAATCT
GTCGCTGCTGCAGCATTGTGAACAGCATGTTTTCGGCATAACCGCTCATACGCTCGGTTTCGCTCGACGACAGGTCATGCGAGAAGCTCGTCACCGCACT
GTACCGCAATGAACCCAACTGGCCAAGGAATCGGTAGTAATAACCGTCCGCACGCTGCCACAGCCACATCGGCGTGTTCTTCGCCAAGGTCTCTTCAGCG
GGCTTAGACTGATGGGCACCTCCGGGCTGTTTGCCCTTCTTCTTTCCACGCTTCTTCTTGTCCTCCGGGCCTCTGGCACTGGTTGAAGCACTCAAACTCT
CGGAATCAACAGCTGCCTCCAGTTCATCCACATGAATGCAGTTCTCCACGTCAGGCACATCCAACTCGAACAGTTGCTGAATTTGTTGTTGCTCAGCAGG
CAGTTGAAGTCGGTGGTACGCCATGCCCTGGGTCTTCAGCTCGCTAAGCAGATCAATCAGTGCCTTCTTCTTCGCACCCTTCGGTAGACCCGTGGCCTTC
TGAAGCTTAGCCATCCGGTAGAAGATTGTCTCGCAAAGATCCTCACACAGGTCACGCACTTGCTGGCGGCGCTCAATTTGTTCAAGCGACAAAATGTGCT
TTTGAGTGTACTTCGCAATGCGCTTTGAGAGCGTAGGAAGCTTCGCGGCATACGATGAGAGTTGAAGCGTGGCATCATCTTCGTACTCGATCAATGGCGC
GCTTGTGTGATTCAAGCGCAACGCTGGCGGTTTTCCAGCATCCTGCGAGTCCTCCTCATTAAGCAGCTTCGTCTTTTTGTCGGCCTTTTCGCTGGCTTCT
CCTTCGGCAGATGCGGTGATCGCGTCCTCATCTTCGTTGTGCTCAACGTCCTTTGGCACGACAACACCATCGTCAAGACCAGCCAGTTCCGCCTTGGTGG
ATTGAATTCCGACAAATCCACCTTCCTTGGTAATTCCGCTATCAGTCGAAGCGTCGATCACAGTTTGCATCGAGACTGTCAGCACTGCATCGTAATCGCG
GACAAACTTCATCAGCTTGCGGTGCGATTTCTCTGCCGACTCAGCGAGCGAATAGTACGTTTGTTCGTCCCAGCGGCAAATCTTGACGAATTCAACAAGC
TTGCGCTGGATTGGAGCCTTCATGCCGCTCCACTGGCGCTCCAGATATCCCAGGTGTTGGCCATAGTACCGGTACAAGTGGTACAGCATGTTGGCCAGAG
CATACTTGGAAGACTTCGAGGCAAAGCCGTTCGATGATTCGTGATGCTCTGAAGGGCTCCAAAGCTCCATGAACAACTGCGCACAGAACGAGTAAACCAC
AAGCAAGCGAGTCTCGTACTGGCCGATCGGGCACGAACGGATGTAAGCGTCCAGAGTCTCGAACAACCTGCTCATAAACTCACGCTGCTTCTCGACAGTC
TCTCTGGCCGCATCGCTGAGGGCTTGAGCGTCGGCCCTGTTCTCGCATAACGGCGTGAAAAGCCACTTGGACAGATGATTCAGGTGGAGCCACTGCAAGT
TCTGCGGGTTCGCGGGGATCATAGCACCTTCATCACTCATGCCCGAGTCTGATTCAAACTGCGCCGTCAGCAGCGAGTACATGTTGATCCACGTCTTCTG
TGCCGCAAAACGATGCTGCTTTTCCTTCACGTAGAGCAGGTGAGGCCAAGAGTATAGCTCAAGCTTTCGCCAACGCGTCACCAACGCCGAGAGAGCGCCA
AGCTCCTCGCTAATTGAGTACGCCTTTGCCGCATACATTTCCCACTCCTGAGCCTTACGCAGCAGCAGTTCAACACCCGTAAGCGTGCGGACCAGCGGAG
AGCTGAT